Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22145  (registered. 2003)
Contig Information
Length 974 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VSCB Liquid cultured tissue 3
Homology (BLAST) Top Hit Shaggy-like kinase [Triticum aestivum]
Score 907
Evalue 9.31983e-96
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22145
AGTACATAGCACCACTGCAGTAGCAACAGGTAGCCTTCAACAACAGGAATCTAAAACCAGGTGGCGGTGTCCGACGAGCAAGAAACTAGGAAAATCTTGA
GGACCCAATACTAGGATCAATTACCATAAATACATTCATACTTCTCTAGAACATATTACAGATCAGCCATGGCAATCCCAATTCTCAGGCGAGGGTTAGT
ACAAGGGAGGATGAACCGGTTACATTGTCAAGCTTGCATCGCAGCATACTACTACTCAGCTACACAGGTCAACAGGGTGGAGTGGTCATACATCACGTCT
TCCAACAACCATAATAGTTCATCATGCTCGCATGCTGCCCAACCAACATCCCCAGGGGAAATGTGGCACTTGTCGATGCAATTCCAACGACTCGTGCGAC
AAGCATCTCATAGTCACGCATGGGAGCTCTGCTTTCTCGCATGATCTGGGATCAATTTTGCCGCAACATCCGCTGGGATTCCTTTCAGTTCGTTAGGCTT
GAAGTTAAAAAGAGGAGGCAGAAAGCGGCTATTCGGAAGGCGGGTACCCGGGTCCCGAAGCTCATCAAAGAAGGGGTGAACAAGTGCCTCAACAGCAGTG
CATCTTAGGTTGGGCGAGTACTGGAGGAGCCGAGAGACTAGATCAACAGCTTCAGGTGGCATCCTTTTATGGAATACCTTGTGCCATGGGTGTGCTTTAA
TCTGTGGGAATTTGAACTCTGTATAATTTGGGTTCATGCATTTAATTTCTTCCCTTGTAGGGGTACCAAGGACCTTGATGATTTCAACAAGCTGGTCCAC
ACCACTTTCACCAGGAAACAGAGGCTGCCCTAGCATAAGCTCAGCAAGAACACATCCAGCAGACCAAATGTCAATGGCTGTAGTGTACTCAGTAGCACCA
AATATGAGCTCTGGAGCCCTATAGTATCGGGGAACAAATGTATGATATGTTTGGTTCTCCCCTTAAACAAGAAC
page-top