Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22111  (registered. 2003)
Contig Information
Length 1462 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 1
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit Os01g0512100 [Oryza sativa (japonica cultivar-group)] >gi|56201625|dbj|BAD73072.1| putative Altered Response to Gravity [Oryza sativa Japonica Group] >gi|56201814|dbj|BAD73264.1| putative Altered Response to Gravity [Oryza sativa Japonica Group] >gi|113532707|dbj|BAF05090.1| Os01g0512100 [Oryza sativa (japonica cultivar-group)] >gi|215767161|dbj|BAG99389.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1161
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22111
TAGTTGATGAATAGTACACGATTTTACTCAAAACTGCTATGCTAAAAGAAGAAAAAACAAGAATCGCCAAGCGTACAGCTCAGAAGGCACAAATACAATT
GAGCTTCTGTAATGTACAACAGTGGATGTGCCGATGCTGACATCGATGAAAATAAATTGCTCAGGCTCTCTTGTCAGATCTATTAAGATTTAGATTAAAC
CACTTCTTTTTACTCGATTTGTCCCTGCTATCTATGTTACCATTCTCGGAACTCTCAGTTTTGTTTTGCTCAACTGGATATCTACTGCTGCTGCTACCAG
CTCCGAGAGAGCTCGTGATAGTTCGTTCGGTCGTGAATGAAGAATGGATGTCATCCCTTTCTCTCAACATATCATCAACCACTTCTTTTTCTTGTGTATA
TCTGGTGGTCGCTTCCTGAAACCGTGCCAAAGCTTTTCTGTACTCAGTTTCGAATTGACGCAGATCAGTTCTTTTCTCCAGAATTTTAGCCTCTATTTCT
TTTAGCCTCTCTGTTGTGTCTTCGTAACTCTTTGCGCACATTGCTTCAATTGTATAGCTGGCTGGCTTGAAAAAATTGTCACCATATACAGCAAATATAT
GAGTTCCAGGTTTAAGTGTCGAGACTTCGCAAGGTTGGAGACCTTCCAATCTTTTAAAGAATGCAGCCTCAGGATCTTTAGCCATTGCCAACGCATTCAC
TGTCGAGTCCATACGGTAGACTTGAAAATGCAGGAAATACATGCCTGCAGATGTCACCTTGCCAGTCTTCTGACTATCTTCCTGTAGAGCTAGTCCATAG
CCTCCGTTGATTTCTTGTTCGAAGAAAAGAAGCTTAAATTTACTTTGTGCAACTGAAGTGGCTCTAACTACTATTCCTGAATGAGCTTGCTCTTCACTTA
TTGTCACACCAAAGAAATGAGCAGATTGCTTTTCAACCTTTCCCATAGCTGATGTCCCCAACTGGGAGTGGTCTCACTGTCACTGTTCCATTCATAGCTT
CTTCAAGAACAGTAGGAGATACCGTCGTCTTGATAGGAACCCCGAGCTTGCTGAAAAGTGCAGCAAACATTGTGTTCACAGTTCCAAGATTGGACAAATC
AATCTCCATATCCATTCCTTCATTTTCCAACGCCTCAAAACCAGCAGTGTCATATTGCCTCCGTTTCTCAGGATCTGACAAGATACTGTACGAATATGCA
ACTTCTTTGAACAGCTCTGATGCTTCTGGGTTGCTAGCATTTTTGTCCGGGTGATACTTGAGCGCGAGCTTGCGGTAGGCGGACTTGATCTCCTGGTCGG
AGGAGTCTCTTGATACGGAGAGCACCTCATACGGGTCCCGTCGGAGCGCTGGCGCCGACGGCCCCTCCATCTTCCCCGAGGATGCCATCAGGGAGCAATA
CCCTGCGCGAGGATGCGGCCAGATCTCGCCGCCTCCTAAGAAAAGATACGGGACGGCAAGAC
page-top