Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22110  (registered. 2003)
Contig Information
Length 1419 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit Os01g0200000 [Oryza sativa (japonica cultivar-group)] >gi|20804509|dbj|BAB92203.1| putative autophagocytosis protein [Oryza sativa Japonica Group] >gi|113531844|dbj|BAF04227.1| Os01g0200000 [Oryza sativa (japonica cultivar-group)]
Score 1410
Evalue 7.60019e-154
Total Hit Count 176
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22110
TTTTTTTTTTGTTGGCGAAGAATCACAAATGTCATCAGTGCGGCGCTGCACCGTAAGAGGACAAATCGGCACAATCTTCCTGCAGAGCATCAGAGTTTAC
AATTGAAAGTTCATTTCCAGACGAACCAACACACACGGACACAATGTACAGATCCTTCCGAAGAGCAGCAATTATTCGGCGACAATGACCAGCCTGCCTT
CTTGGAAGTTTCAGCTTTTCTTCAATGGGCGACTTATGTGCTTGTACTGCCCAGATCGAAGTCCATAGTGTAATCATACTCAATGGTGGGTATGACAGAA
GCCATGAATTTCAGAAATATGAAAAGGTACTTGTCAACTTCTGGTGCACCTCCTTGAGACACTATAACATCAATGATCTTTTTCATCACAGCAGCGTGCT
TGCAAGGATGCACTGAAGCGTGCTGTCCCACTAACAAGTGAGGGTGGTCTTCGATAGTCACCGTTTTGTGTGCATGGTCTTGACTGATATCTTGAAACAC
AAGTTCAGGCTTTAATGGCATTCTTGCCTCATCATAGCCTGTAAGCCAGACACGTGGAGTTTGGTAGTACTTGTCATATGTGATGCTGACATCATATGTT
CTGGTGAGAAGAATGTTGTCATCATCAGGCTCTTCTGCGACAAAATATGAAGGCTGAGGGGTAGCTGTGGAATGATCTCCTGTGTCTTCATAGGTGTCCA
TATCAGGTATATCCTCCTCGTCATCTGGCTTTTCACCAGCACCAAAGTAGGAGGGGATAGATTTGATCTCTTCAACTTTCCCTATGTCCAATGTATCCAT
AGACGGTATGTCTTCCTCCTCTTTTGACTCTGATGCTTGCAGCCCATGTGTTGCGAGCCAGCCTTCGCCATCCTCATCATCATCGAGAACAACCTCAGCT
CCCGCTGCATCATACTCTTCCTCGACCGCCACAGCTCGTCTTAGGCAGGGCACGTTCCTGGTGACGAGGAACTGCTTATCGGAGGGGAGGTATGGCTTTC
TCTTGCTCGGATCGCCCGCCTCCCAGGACCAGGTGGGGCACTTGGATACGAGGTTGTCGCCGGCGAGGATGAACTCGGGGACGGAGAGGACGCCCTTCTC
GAGGAACGCCGAGACAGTGCGCGGGCCCGTGACCCGCTCCACCGTCCCCTTGTAGAGCTCGTAGACCTTCTGCTTCACCTGCATCGTCGCCGCCTCGCCT
CGCCTCGCCTCTCCTCGACGGAGACGAAGGGGGAAGCGTGGGAGAGAGGGGCAGGAGGAGGAGGATGGGTTTCGTTTGCCTCGAGCAGAAGGCACCGGCG
AGAAGGTGGAGCAGGGCACAGCCGTCTCTGCTGTTTTCTAGTAGTACGCCACCGGAGTTTTTTCTGAGGAGGAGTACGCTACCGGAGTTGGAACGCGCAC
GATGTAGGAGTGGAGCCGG
page-top