Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7551  (registered. 2012)
Contig Information
Length 1368 bp
Clones alternative view 48 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 15
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 5
WH_XE Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|82592996|sp|Q687E1.2|NPP_HORVU|NPP_HORVU RecName: Full=Nucleotide pyrophosphatase/phosphodiesterase
Score 734
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7551
TTTTTTTTTTCGATAAATGATGCTTTTATCATTCCATAATATAATATCAAGGAGTTACAAAGCATAATTAGCATACACCTGCCTCTTGTATGATTAGTAT
GCGCACATCTAACACCAACTCATACCCACGAGATCTTTTTATTAGCACGTATAAATAGTGCAGCTGACCAATTTTATTGCTCGATACTCCATGACGGTTG
GACACCAGGTACTCACGCCCACGAGATTTGTTTATTAGTACATATAAATTGTGCGGCTTACCAATTTTATTGCATGACCCTCCATGAACGGCCAGACCAT
CAGCTAGCGAGTGTGGTGGGGAAGCAACTGTCGTGCACGCAGCTGAGCACGTCACGGTAGTCCCTGTGGATGGTGAAGGAGTCGTAGACCTTGCCATCGC
TGCTCTTCATGTACTCAAACAAAAGCGACGAGTGGTTGAAGGCCGTCAGCTTGGTGAACCCGTAGTCGTGATCCCTGAATATGCTCCACTTGGGGATCGC
CGTGGTGTACTCCGACAGGTGGCTACCGCCGCCGCCGGCCACGACGAAGATGGTCCCGTTCATGGTGCCCGAGTAGTGGCTCTTCTCGTTGTTGACGCAC
TGGCTCTGGTAGAGTGGGCATGTACGCTCGTAGTTGTGGACGTGGCCGAAGTAGGCAATGTCGACGCGGTACTTCTGCCACAGTTTCTGCAGGCTCTCCC
GGCCCTCTGGCTCCTCGAAGGAGCCCTGGTCGGCGTACCACGAGTTGGAGGAGTAGCCGAGCACCCTGTGCGCCGTGAAGATGAGCCACGGCTGGTGCTT
GCGGTCCACCGTGGAGAGGCATTCCTCGATGAACTTGTACTGTTGAGTCCCCTCCCGCCAGTCGTGCTCCGAGTCCGCCACGCAGAACCGGAACATCCCA
TAGTCCACCTTGTACCAAAAGTTTGCTCTGTTTTCGGCTGGGTAGTAGTACATGGTCTCGGCGGGCACGCCGCATTCGCCGCCGGAGTCCTCGACGTCGA
AAAACCCACCGGTGTTGGGCCAGTCCCTCTCGTGGTTGCCACTTGCAACCATGTAGGCCTTTTTGGCGCTGATGGGGGCAACCTGTGCGGTGAACTGGTC
CCACTGCGAGAGGTACCCGTTAGCGTAGGGCATGTCGCCGATGTGGAAGACGATGTCGTAGTTGTCCAGATCTTCAATCAACCTATCCGTCGTGTTGAGC
GATCCTGGCTGGTAGTTGGCGAACTCGTTTGATCCGTCCCTCTCCGCCTTTCCCATGTCACCGAAGACGATGATGCGCTGCAGCGAGTTCTGGCCGGGGG
TTGGCGGTGCCCGGAAGGTGTAGGGCTTAGCCCACACCACGGTTCCGTCGGAGAGCTCATGCCCAATC
page-top