Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7548  (registered. 2012)
Contig Information
Length 1374 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226507834|ref|NP_001148102.1|| DNA binding protein [Zea mays]
Score 182
Evalue 9.00E-44
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7548
CCCTCCCCACCCCTCGATCTGATCTCGATTCATCTACCTCTTCTCCCCGAATCCTCAATTCGACACCAGATCCGGTCCTCCCTCGCCGAGGCCTCTCTAT
TGGTACCGATTTCGCCCCGTATCGTTGATTCTGTGTGTTCCCGAGATTAGGGTTTCGAGGCGCTGAAATCGGGTACCGATTGGCTCGATTGAGGCGGGAT
TTCTCCAGGGGAGGCTGGTCTGTGGTTGATTGGTGGCTCTGAGATCCTATTATTGCGGTTCCTTTCATCGAATTTGCGCGATTTGTTTGCTAGGGTTTCG
TCGTTTCCCTCGCGTCCAACCCTCCGACGACCCCTCATCGCCAGAGCATTATGTTGCATCAAGAAAATAGTGAGGTTTATGTGAGGCACCACTCTGAGCA
GCTTGCATGTGGCAATCTGAGGGGAACCGATGATGGGCGCTCAAACTTCCTTCCTGGGAAATACCATATTGCAACAGAATGGAATACCACAGCTTGTCTA
GTTAATACTACCAGTGCTGTTAAAGAAGTGACAGTCGATCATTATAAGAGACCTGCCTCTAGTGGTTTCCCAGACATGTTGGACTGCAAACGGATGAAGC
AGGAAGAGCAAACTGTATCTGAGAAAGATAATGCAGCAGATGCTGACATAAATGTTCCAGAGTATGGATCATACAAGACATGGGAGAGAATCTCCGATCC
ACCAGCGTACGGTAGTGAGGAAAGTGAGGATGAAGGTGTAGATCCACCCGTTAATTTTTCACTAGCCCAAACTTATGTTGAAGATTACCTGCGATCTGCA
AGTTATTATCAAAGGGAAGACATTTACTCGTCTGTTAGCCTTTGCCCTACAAGGAAAACTGTTCCAATTGGGCCAAATTATCAGGCTGAGTTGCCAGAGT
GTGCATCTGGTAATTGTAGGAGCTCAGTTGATGGTAATGCTGATGTGTCATCATCTTCTCACATATGTGATATAAAGGAAGCCGGGAGTGACAAGTGGAT
TAGGAACTCTGTTATTCCAATGCCTGGTTCTGTTGAGTTATCTTCAGTGCTGAAACCTGTTTGCTGTAAGACAGATTGCAGTTGTGTTGATGAAGGTTCG
ATTGCGTGCGTGAGGAAGCATGTGAAGGAAGCAAGAGAAAGACTAATGAGTGCCCTTGATCTGAACACCTTCAAAGAGTTAGGATTCTTTGACATGGGAG
AGGAGGTGGCCTTGAAATGGACTGAAGATGAAGAGCATTTGTTCCAGGATGTGGTATCATTAAACCCTGCCTCTCTTGGAAGGAACTTCTGGGATGAACT
TCTGCTTGCCTTCCCATTGAAGACTAACAAAGAGTTAGTGAGCTACTATTTCAATGTCTACATGTTGAGGAAGA
page-top