Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig22012  (registered. 2003)
Contig Information
Length 864 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsJ_024444 [Oryza sativa (japonica cultivar-group)]
Score 1016
Evalue 1.75092e-108
Total Hit Count 177
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig22012
AAGCAGCAGTAACAATTTATCATTGTCATGTGTTACAACAGGCATGGAACAGACATGATACTACAAGGGTTTGCTCTCAACGCTAGGTTGAGTGAGATTA
CAGAATACAAGAGCTTATTGGTTTCACAGGGGTTCCAGCTTCTCCCCTACCTCGAACCAGAAGAAGACGGACCTGCGGGCGTAGATGGCCCGCACGCGCT
GCAGCGCCAGGGTCCCGTTGGTCCGGATGGCCTTGGCGCCGCCTTCGATCCGGGTGCGGACGACCGTCACGCCGTGCCCCTGCTGCTCCTTGAGCGACGA
CGATAATGGATTGTATTCGATCGCCGTGCTGACTATCGGGAAGGACAGGTAGTCCAGAGGGTTTGGCTCGCACTGGAGCAAGCACTCCTGAATAGTTAGC
TTGCCGCTCCGATGGAGCAGGCAGCATCCGAGCTCAGCCTTGATGGTGAGGTTCGCGATCTTGCAGGTGGAAAGGAACTCCAGTGCATTATCGGAGCCAC
GGGAACATGTCAATACAGTGTCATCAGGAAGCTCACCCCCGCCAATAATGCAAAGGGGCTTCTTTATTTGGATATTACATGCAAGATAGGTGCCACCGGC
AGCAATTAGAATAGTGTCACCAGGCCTAGCAGCAGAAATAGCAGCCTCAAGATCTGGATAAACTCCAGGCTCCTTTACATCTCTGAGCGGCCTCTCAACA
CGCAACCACAACCGAGGATGGCATGCAAGGAAGCGCCATCTGTGGCAAACGAGGGCGGTGTTATACCTATCTGGAATCGGGCTGAGGAAGCTGAAGATAT
GCATGAGGCAGCCGTCGTCCAGGCCGTTCACCGGCGAGCCCGGCGCCTCCCCCCACGGCGCCGC
page-top