Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21970  (registered. 2003)
Contig Information
Length 1123 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_OKCS Seed DPA5 4
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsJ_017987 [Oryza sativa (japonica cultivar-group)]
Score 1394
Evalue 3.94971e-152
Total Hit Count 453
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21970
TTTTTTTTTTCCTAGGATTAGATAGGAGTTATACCAGGCAAAAATACCAATGCGCTTATTCCAGTACACAGCAGCTAGAAAATCTACCAGATCCAGACCC
ATACAATACCCACATACAAACATCCTTATTGCCCGAGAAGCGCAGAGGGCCAGCCAGCCAGGGGCCGTCCCAGAGAGACACCATACCGGCTTAATGTATT
TACACTCACGCAGGATACAGAGGCACAACAGACTGCGGGTAGTCGGACCTCTTCCCAGAGAGGGAGTAGTACGCCAGCACCTGAGCTTGCCTGTCAACGC
AGGGCTCCCCGTCTTCCATCACCCGGCCCGCGGTCTCCGTGCTGGGAGGCGTGAACTCGATGTTCCAGAAGGGCCGCGCCATGAGCATGAGGTCGCGGCC
GGTCTGAGAGGCCCTGTAGCCCTGCACCCACACGTACCTCAGGGAAGGCATTTGCCGTATGGCGAGGGCCAGAGCCCGCTCGCTGAAGCAGCAGCTCCTC
AGTTCAAGCTTCCGCAGGTTCCAGCACCCGGCTGCGAAACTGATCAGTCCACCATCCGTCTGCCCGACGTTACCCAGAAGCATGTACTGGATGGTGCCGC
TGTGCTGCCCGATGTAGCCGAGGCCTACATCTGAAAGCCCCCCTGGTCTCAGGTACAGAGCGAACCTCCGAAGCTTGGTGCAGCCCCTCAGCAGCGCGCG
TGCACCGCTGTCCAGCGGCAATTCTGTTATCGTCTCTTGTCTGTCAAGCAGGACAAGGCGAAAGTCATGGAGGTTTTTGCAGAACGTTCCGATGGACTCC
AGGGCTCCATTTGTGATATCAGACACATAGGCAGCTATGTTTTCCAGTTCACGGCAGCCTACGGCTATCGCTGTTAGTCCTACTTGGGAAACTCCGCCTT
CCTCTTCTTGCATGCCAGGATCATCTTCCCCTCGCTCAACTCTGAGCCTTTGTAGCTTCTTGCATGTGTCTCCGACAACCCCCAATCCTCTATCTCCAAT
CACATTCCTCACCGCAAGAACGAGTAGGTTTGGACATTTTGCAATGAGCTGGCAATGATCTTCAGTGGTGAGGAAACTGTACAGCAAATCCAGCTTCTTG
AGTACAGCAGAAAAAGGAAAGAT
page-top