Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21961  (registered. 2003)
Contig Information
Length 1498 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 3
Homology (BLAST) Top Hit Os02g0705100 [Oryza sativa (japonica cultivar-group)] >gi|41053091|dbj|BAD08034.1| hydrolase, alpha/beta fold family-like [Oryza sativa Japonica Group] >gi|41053146|dbj|BAD08089.1| hydrolase, alpha/beta fold family-like [Oryza sativa Japonica Group] >gi|113537396|dbj|BAF09779.1| Os02g0705100 [Oryza sativa (japonica cultivar-group)] >gi|215693349|dbj|BAG88731.1| unnamed protein product [Oryza sativa Japonica Group]
Score 589
Evalue 3.09374e-122
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21961
TTTTTTTTTTAGGAATTCAGCTAGGTGTAGGTTAGAGGAGTAAAATAAATTTTGTACTTCTCTATAGCCTTTTAGATATCGGCTAGAGATGCTCTTACAC
TTCTCAATTTACTCTGTTCCTATCTACGTAGCAAGTATTGCTACAAGCTAAATGCCACTTGTAAGCTAGTACCGGGTATACATCTTCACGATCCTCGGCA
GGTCCCGTAAGCACACGATCTTCTTCACTGGAACGCCCTCTGTCGGATTGGGGTACAGGTACAAGAATCACACGACCTGGAGGCTGGGCTCGGCCGGCTT
GTCGCCGGCCTCCTCCTCCAGCGACGCGAGCCACTGGAGCAGCGCCGCGTTGAACTGCTCCGGCGCCTCGTCGTGCGGGCAGTGGCCGGCCTGCAGGTTG
ACGACGGTGGAGTTGGCGTAGAACTCGTGGATCCTTGCCGCCTTGGACGGGCCGACCCACGGGTCCAGGTCCCCCCACAGCAGCAGCAGCGGGCACGTCA
GCTTCCCCAGCAGCTTGTCCAGCGTGTACTGGCTCTGCTGGTTCGCCACGAACCGCGACATGAGCCTGTAGTACACCTCGCCGGCGTTCGGGTCGGCCGT
TGGCGCCGTGATCGAGCTGATCAGGTACTCGTCCACGTTGCTCGGATCTTTGTACACGCTTTTGAGGACTTTCTCGACCCTGGCCGGCTGCTTGGCCTGC
CAGAAGAGGAACCCGAGCACGACCCGCTGGAAGGCCTCCTTGAGCGGCCTCACGATGAGCCTCGTCACCGCGCTCGCCTCCTCCTCCGCCACCGCCGCCT
CTTCAGCCTTGGGCGGCGCGTTGGGGGTCCCCGAACTGGCCGGCGGAGTTGAGCAGCACGACGCCCCCGGACCAGCTCCGGCACCTCCGTCGCGGCGAAC
AGCGTCGTGAAGCCACNTAAGCTGTTGCCGACGACGACGGATGGCGACTGGACGACCTCCCTGAGGAAGTCGGAGACCTGCTCCATCCAGATGGTGGCGT
CGTACTGCACCAGCGCCTTCTCGCTCCAGCCGAAGCCCAGCAGGTCCACGGCGTACACCTTGTACTTCTTGGCCAGCTCCGGGATGTTGTACCTCCAGTG
GAACGCCGACGCGCCGAAGCCGTGGATGAGCACGATGGGCTGCCCGGACCCTTGCTCCACGTAGTGTATCTTGCGGCCCCTCCACGTCCAGAAGCTGTAC
CCGTCCGCCTTGAACGGCAGCCTCTCCAATGCTGCAAGTAAACGAGATGAAGAACATGGATCTATAGATGTCTCCACTCTGAACTCTGAAGAAACAGTTA
AGCTAAGGCTGACCTTGAGCAGCGGCGCCGTTGGAGGAGGAGGTGAGCAGCGAGGAGCAGACGGAGAGCGCGACCCCCTTGGTGACGAGGTCCCTCCTCT
GCATCATCAGAAACTTGTTGCCTCCGTTGAGGCCGGTTCCGACGCCGGAGCAGCGGCCGGACGACGACCGGAGGGCGGCGGCAGATGCCGAGGCGACG
page-top