Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21949  (registered. 2003)
Contig Information
Length 1557 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit Os01g0840200 [Oryza sativa (japonica cultivar-group)] >gi|15623836|dbj|BAB67895.1| putative SLT1 protein [Oryza sativa Japonica Group] >gi|21104623|dbj|BAB93215.1| putative SLT1 protein [Oryza sativa Japonica Group] >gi|50726944|gb|AAT81168.1| sodium/lithium tolerance protein [Oryza sativa (japonica cultivar-group)] >gi|113534289|dbj|BAF06672.1| Os01g0840200 [Oryza sativa (japonica cultivar-group)] >gi|125528328|gb|EAY76442.1| hypothetical protein OsI_04376 [Oryza sativa Indica Group] >gi|125572586|gb|EAZ14101.1| hypothetical protein OsJ_003926 [Oryza sativa (japonica cultivar-group)] >gi|215697702|dbj|BAG91696.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1687
Evalue 0
Total Hit Count 38
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21949
CTCACGCACTCACTCAACAGTGGCCTTTCAGAGCGCGGCGGTCGCCATCCTCAGCCTCGTGCCGAATTCGGCACGAGGGTCGGACAAGGCCAAGAGCAAG
GTCGTCCGGGACGCCAACGGCGTGTCGGGGTTCGACAAGTCGGACCTCCGGCTCGACATGTTCCTGGTGCAGCACGACATGGAGAACATGTACATGTGGG
TGTTCAAGGAGAGGCCGGACAACGCCCTCGGCAAGATGCAGCTGAGGAGCTACATGAATGGGCACTCGCGCCCCGGCGAGCCGCATTTCCCTTTCAGCGT
CGACAGGGGATTTGTCCGGTCGCACCGGATGCAGCGCAAGCACTATCGGGGCCTCTCCAATCCGCAGTGCATCCATGGGATCGAGGTGGTGAGTTCGCCG
AATCTCGTGGGCATCACCGATGTGGACCGGAGGAGGTGGGCGGAGCTCACAGGGAGGGAGCTCAATTTCTCCATCCCGCAGGAGGCCAGTGATTTTGGGA
CATGGAGGACCATGCCAAGCTCAGAGCTTGAGCTGGAGAGGCCACACACACACACTGCCATGAAGAGCAATACTAATAATGTTCAGCAGCAGCCCCCCAA
GAAGACGCTTAATGGATCAGGCTTGAATCTGTCATCACCATCCAATCATTCAGGAGAGGACGGCATGGATCTATCCCCTGTCAGCAGCAAGCGAAGGAAG
GAGGCATTTCCACATGCCATGGATGAGGAGTGCTTCTTGCCTCTGAACCCTTGCACCGGGAGGACACAACAAGATATCGAGATGCAGTCAGTAGTGCGGC
CTTCGTGGATGCACGAGTTCACCGGGGTGATGAGGAAGGCCTCTGGGCCGGCAACTGCTGCCAAGTCCATTTACGAGGATGATCAGGGCTACTTGATAAT
GGTCAGCTTACCATTTGTTGATCAGCAGAGGGTAAAGGTTTCATGGAAGAACAATCCCACTCATGGCATAGTTAAAATCTTCTGTGTTAGTACAGCCCGG
ATGCCATACATAAGGAGACATGATAGGGTCTTCAAGCTTACTGATGCTATGCCCGAGCACTGCCCTCCTGGGGAGTTCATCCGTGAAATACCTCTAGCCA
CCCGTATCCCCGAAGACGCCAAGCTTGAGGCATGCTTTGATGAGGCCGCTGCAGTTCTTGAGATCATGGTCCCCAAACGGGGGAACGAGCCGGAAGAACA
TGAAGTCAGGGTCTCCATGCGCCCTCCTCACCTTGGAGTGAACGACCTGCTTATGACATAGGTAATGGGAGGTCTATCTTTCTTGTCTGTGATCACCAGA
TCGTATGCTGGAAGGGGCTACTGTTAGCGTCTTGTTCCGAGACTGTTGCTGTTGCTTACTGGGCTAGGCCTCTTCAGCAACAAGCTTTTGCTGAAGATTA
GTTCGTTCTAAGCTTGTATGTGACGGGTGTCTTTTTAACCCTCGTGTTCTCTTCTCCTAGCAGCATATTGTGGGTGGCCTGTTTGTCCTTGAATCTGTAC
CAAGTTCAGTTAACAGAATAAAATTTATATTTGGTGGGTTACTGCTCAAAAAAAAAA
page-top