Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21943  (registered. 2003)
Contig Information
Length 693 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 3
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit aquaporin [Hordeum vulgare]
Score 690
Evalue 7.30732e-71
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21943
TTTTTTTTTTAAACAACTTGGCTCGATTTGACAATAACGGGCAGCACACACAACTGAGTACTGATGAGATTACATACAAGTCTGGGTCCAGGTTCAGGTG
AATACAGAGTACATCAAACTTGGAAGACAAATTGGAATTCCACAGTAACACGGATGACGGGAAGAGATATATAGCCGCCCCATCAGAAATTCAGAACACG
CAGCTTGCTCTTCGGGTTGGGTTGGCATCTTCTTTGTAGCAGGAAGAACAGCTGCTTAGGACTTGGTCTTGAACGGGATCGCTCTGATGACCACCTGGTG
GTAGACGGCAGCCAGCGCGGCGCCGATGAAGGGGCCGACCCAGAAGATCCAGTGGTCTGACCAGGCGTGCTCCCTGTTGTAGATGATGGCCGCGCCGAGG
CTCCTCGCCGGGTTGATGCCGGTGCCGGTGATGGGGATGGTGGCCAGGTGCACCAGGAACACGGCGAACCCGATGGGCAGCGGGGCGAGGATGGGAACGT
GGGAGTCCCTGGCGTTCCTCTTGGCGTCGGTGGCGGAGAAGACGGTGTAGACGAGGACGAAGGTGCCGATGATCTCGGCGCCGAGGCCGGAGCCCTTGGT
GTAGCCGGGCGCCACCACGTTGGCGCCGCCGCCGTTGCCCATGTACAGGCCCTGCTGGAACCCCTTCACCACGCCGGCGCCGCAGATGGCGCC
page-top