Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21937  (registered. 2003)
Contig Information
Length 2129 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 4
Wh_VABA Shoot with ABA treatment 1
Homology (BLAST) Top Hit hypothetical protein OsI_37599 [Oryza sativa Indica Group]
Score 1889
Evalue 0
Total Hit Count 286
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21937
CCCTTTGGAGCACAAACTTCTCCATTCGGCTCTCAAACAGCTGCACCAGCATTCGGGCAAACTACGTTTGGAAGTCAATCTGGAGGAACCAGAATACAGC
CTTATGTACAAACACCTGATACTGACACTGCTGCAAGTGGTTCTCAGCCTGCTGCAAAACTTGATTCCATATCAGCCATGCCTGCATACAAAGAGAAGAG
TCATGAAGAATTGAGGTGGGAAGATTATCAGCGTGGGGACAAAGGTGGACCAAACTCTTCTGNAACTCCAGCAGTGAACAACTTCTTATCTCCACAGCCA
AGTTTCCAACCAAATCAACCAGCACCAGTGAATCCATTTACTAACCCCTCACCCTCACCTTTTTTGAGTGCTTTTGCTACTACTCCGAACCCGTTTTCAT
CGCCCGCAACTACTACCTCCTCGTTTGGACAAACAAGTGGTTCTACATTCCCAGCAAACACTTCATCTTCTCTATTTGGAAATAATACCACCACTTCACT
ATTCAACAACCCAAATCCTTTCAATGTTGGGTCATCCACTAGTAATAGCACTCAATCATCTGGGCTGTTTACGTCTTCCCCTACAATGGGGCAGCAGCCA
TTTGGCCACTCATTTAACCAGCAATCAAGCACTCCAGCTTTCTCCACCAGTATGTTCAATACATCTAACATCGGAATCACTGGAGGTGGAGGGATGTTTG
GCAACACATCTTCACCTTTTCAAACATCATCATTTCAACAATCTGCCCCTGTTCAACCTACAAACTCGTTCTCATTCCAACCTCAGACTCAACCAGCTTT
GACAGGTGGATTCTCTGGTGTTTCCAACCCGATGAATATGGCTCCATTCGGACAGCAAACTACTAGCCAGTCCAATATGGTAATGCAGCCGACTCTTGTT
TCAAATCCCTTTGGGACCCTTCCAGCAATGCCTCAGATGTCCATTGGGAATGGTGGATCCTCACCTTCTATCCAATATGGGATATCAAGTTTGCCGGTTG
CTGAGAAGCCCCTTCCGAGCAGAACATTATCAATGGTGGTTCCTAGGCATTTGTCACAGAGGAGGATAAAGCTGCTGCCACGAAAATATAATGCAACATC
CAATGGCAAGGTTCCATTCTTTGCTGATGATGAAGAATCCCCTGTAACACCAAAAGCGGATGCCTTTTTCATCCCTAGAGAGAACCCAAGAAGTTTGATA
ATCCGTCCAACAGACCAGTGGCCTTCACGTAGTGTGGTTGGCCAACAATCAATTCCAAGGGATTCAACTGATAATGACAAACATAAAGATGCTTTTGTTG
GGAGGGAGCACAATAAGGCTGCCATGACACCAACTCGGTCTGGTACAGTGGAGAATGGCATCCACATTGCATCAAGCGAGCCTGGGGATGTGGCTCGGCA
TATGAATGGTGCTACCGTTGAGAAGATGATGCCTAGGCTCTCCCAGGCAGATTACTTCACGGAGCCCAGTCTAGAGGAGCTTGCTGCCAAAGAACGTGCT
GAGCCAGGCTACTGTAGTCAGGTTGTAGACTTCATTGTTGGGCGTGAAGGTTATGGCAGCATCAAATTCTTGGGAGAAACTGATGTGAGGGGCCTTGATC
TGGAGTCGATTGTGGAATTCAATAACCGTGAAGTGATTGTGTACAAGGACGATAGCAAGAAGCCCCCAGTTGGCCAGGGCCTGAACAAAGCTGCTTTGGT
GACCCTCCTGAACATCAAGTGCATGAATAAGAAGACGGGTGAGCAGTACACGCAAGGGCCGAGGTTGGACAAGTTCAAGGAGATGTTGGTGAAGAAGGCT
GAGGAGCAGGGAGTGGAGTTTATCTCGTTTGACGGTGCCAAGGGCGAGTGGAAGTTCAGGGTGAAGCACTTCAGCTCCTACGGGTTTGGTGAAGCCGAAG
CCGACGACCTGGCCGATTCCTTGTAGCTTTGTTGATAGGTGCTTGTTTTCTTTTGGATGAACGGTGGACACTCGATTCCATGTAGCTTTGGTCGATGTAG
CTGGTCTGGGAGAATATTGGTTGTGATGCTTTTCTTCTCTGAATGCTGCTATGAGTTCCTTCCCATGTTCTTCTGTACATATTCTTTTTTCTTGCAGAAT
GCACAAAAATTACATTCTGGCACCAATCT
page-top