Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21936  (registered. 2003)
Contig Information
Length 1831 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 3
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1629
Evalue 4.27365e-179
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21936
AGAGCTTAGAAGCCTTTGTCTCGAGGGAACTTCCCTACGCTATGTACCAAAAGGTGTGGGTGAACTGAAGCATCTTAACCATCTATCTGGTCTGATCATT
GGTCAGGACAACAATGATCCCGAGGGCTGTGACTTGATTCACCTTCGAGCCATGTCTGAATTGAGGTACCTTCAGATAGAGAGACTTGATAGGGCTACTT
CTGGAGCTTCTGCACTCGCAAACAAGCCATTCCTGAAGGTTCTACACCTGTCTGAGCAAGCAGCATTAATTGAGGAAGAAGAGAATGGGGAAGAACAGGA
GAACCAAGAGGGCGCAGAGAAAGAAGAGAAGGACGAACATGAAGTAAAAAATGCTCAGTGGATTAGAGACGATTCAGCTAAAGTGAGTGAAAAGATATGG
AATGAGCTCACCCCACCCAATAGCGTTGAGAAGCTGGTAATCAAGAACTACCAAGGTCGAAAGTTTCCAAACTGGATGGCGGGTCCCAAGCTAAGCACCT
CCTTCCCTGCCCTTGCCTTCCTTGATCTTGACAACTGCATGTCATGCACCACTCTGCCTGCTCTTGGCCGCCTGAAACAGCTCAAGTCCCTGGAAATCTC
AAATGCAGACTCCATTGTCGCCATCGGTTCTGAATTCCTCGGCACCACTGTGATTTCACAAGCCATCTCGTTCCCCAAGCTTGAGGTTTTGAAGCTAAGA
AACATGAAGAATCTGGAAGACTGGTCCTTAAGTGTGGAAGAGAGCCAGACATTGCTGCCTTGTCTTAAGTCACTGCACATACAGTTCTGCCCTAAACTCA
AAGCTCTGCCAGAAGGTCTAAAGGACGCTGCTCTGTGTGACCTTCATGTCGAGGGTGCACATTGCCTTACAGAGATAAAGGACCTGCCAAAACTATCTGA
TGAACTCTATCTGAAAGATAACAGGGCGCTTCTGAGGATCTCCAACCTACCCGCACTCAAGTCACTCACCATCGACGACTGCGCGAAGCTGAAGCACGTG
TCGGGCCTCGACATGCTGCAGCATCTCAGGCTTGTGTTCCCCCCATCCACGGAGACATACTATTTCGAGGAGTTGGTCATCTTCTGGAACATCGCATTCC
CACGGTGGCTGGAGCTGCTGATCCGTTTGCAGGCCAATGGCCTGCGTCGATTCGAGCTGCAGTGTGCACTCCCTTTACTCAGGAGCTGCCTGGAGGGTGG
GAAGAACTGGCACGTTGTGCAGCAGATCCCTGAGGTGCGCATCACAAGCACCGATGGCAAGAAGTACATAAGGTACAACAAGGCCCGTCGCATCTACGAG
ACAAATGCTCAGTGTGAAGAGAAGTCTACCTAAAAATCTTGGTATGCTCTCTTCTTTTCCACTTTTCAGTACTTGCGAAGTTGTCATCTTATCCTTAATC
TCTCTAGTGATATGGTTTAATATGGTTTAAGTACTTGCAGGAGTACTTGGCAGCTGTTTGGTAGACATGTTTGGTCCGACCGTCCCTACTGCTCCAGGAG
ATGTCGTGGTTTACATCAGGGAGTCGTCGTGTTGTTACTAGAAATGGTTTGATGAGGCCTGAGGAATGAGTACCGTATTTTTGGTGAATCAGACAGCAGA
TGGTCTTTCCCCCCCTTCCTCAGTACTGAACTTGGCTTAACTCCTTCACCAATACTCGATGTGTGATTCTTTTCCGTTTCCTGGTTCTGGCGATTTGTAA
ATTGTAAACATTGAGCTTGATGGATTTTGATGAGTGTAAAGTATTGCCACTTGTGTACATGGATTTGTTTTTTTTCTTTTCGTGTCGGAATGTTTTCTAT
CAAACCATGTATATTTATGTAATTGGCAAAC
page-top