Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21887  (registered. 2003)
Contig Information
Length 1685 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 3
Wh_VWD Shoot grown with dessication 6
Homology (BLAST) Top Hit hypothetical protein OsI_29145 [Oryza sativa Indica Group]
Score 650
Evalue 1.28108e-65
Total Hit Count 146
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21887
GAGCAAGTATAAAACAAGGCAACCACAGGCGAACCATTACAAGATATGAAAATAACACCTAGACTAAACGAAATCACTATGCAGACGACAATGCGCTGGA
CAATTCTCAGACGACCTGATGATCGATGGCTGCGGCCCACGTGAACTCAACTGATCGATGGCTGCTATAGCTTGTCGTCCACAGATCGGCCACAATCCAT
CGTGTGTGTAGCAGTCCTCAGACTAAATCAACCTTTTCCGCAACAACGCCTTAAGAAGCTACGAATGTCCTTGTGCCACCATCGCCACGTCCGACCGGAG
ACGGGCTGAACTAGCTGCAGCTGGCGTGTACATAGTCTTATCTGACAGTCCGTGTTCTGTATATTGTTCTATGGCTATTAACCAAAAATGCAGCCCCTTG
TACAAAAAACCCCGACACAAAGCACCTTCTCAGTTCCTTACAACGTTGAAGGAGAACTTGGAGAGCAGATTCGGAATTCCAGATATGATTGGGCCATACA
CCTGAGCATTGTCGTGAATCTGGGACAGAGGCACGGCTAGGAGCTTGAGGTTCCTCGGCACGACGAACTGGCGAGCCATGGGCAGCCTAACCAAGAACAG
CTTCACGCATTCCTTGGGTGCACGAGTGCTTGGAGGCGGATATGGAACTGGCCTGGCCTCGAATTCTGATCTCCACCACATGCCAATGCACTCCCCGATC
TGCCAGTGGTGGTCGCCGTTTGGATCCGCAGCGGCTAGCTTGCTGGAAAGCTTGCGTTTCAGGCCTTGGACATCTTGCTCGGCAGGCCTGAGGCGGCCGC
CCGGGAGGAGGAAGGAGGAGTTCCTGACTTGCAGGAGCAGCACGTGCGGGTGACCCGACAGCTCGACCAGCAGGACGCCATGGACGCAGGTCCGGAGCAG
GGGCGGACCTAGGACAAAATTGTCCCGGTGTCCCAGTGCAATGCTATCACATATGCGTGGATATCAAGTAATGTTATCTTGCCATGCATAAAAATCAAAA
CTCAACAATTAAAAATGTTCAATGATTGGAAAATTGGAAAACCACTCCAAAACTTAAAAATCACAGTAATCTAATTTGCAAATAGACGTGAACCGCCGTA
AAAATTGAGATATCATAGAAATACAATTCTCAAACAGATGTGAACTACTCCAAAAATTAGAAAAACACAATAATATTAATCCAATTAGATGGTAATAAAT
AGATGGAATAGATGCATGAAGGGATGAGCGAGTTGCCTTTGCCGTAATGTCTTCTGCAGCGATCTAGCAACGCCGGCATGTCGCAAGGTGAGTGGCGGGT
TGGCGAACAGGAAGAAGGCAAGGCAATGATGGCCTGGGACGAATCGGATCCGGCTTGCCTGATCCCTCCTCATGCTTCCATCCGTGCTCCCACTTCATTC
TCCGGTTGTTGTTTTTTAATTTTTTTCTTTCTAATCTAATCATCTCCTGATTTTAAGAGGATGGGGCCGGATCTTATTTTGTTCCAATCAAATAAAATCA
CGTACGTGGAAGCACGGATGGGCACACATGCGAACAGTAGGTAAGTCTCTTCCGGAGAAATCAGGTAGAGGAGGGGAGAAACCAGTAGGCAACAGGCGCA
CGATACGCGTAGATTGAATCAGATTTTTTTAGGACCATTCAATCAATCAGATTGATCGACCACATGGGCCGTTAGACGGGCTTGC
page-top