Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21884  (registered. 2003)
Contig Information
Length 927 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 11
Homology (BLAST) Top Hit alcohol dehydrogenase ADH2A [Triticum aestivum]
Score 925
Evalue 7.05256e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21884
TTTTTTTTTTAACACAGAAATTGCACGCTGTACTATTGTGCCATAATTATTAATAGTAATTTACATGCTAACTGAAAGCTGCCGACAGACACAATGAAAC
CAAAGACCAAACCGTGAACACTAAACAAAGAGCATAGATGCACATCTCACGACTAGCAAACACGATTATTACGCGAGGGAAGTTTTCTACTTTTGGCTTG
TGCTTCTCAAGCACCAAATCTTAAAACAGAGAGACACACGATAAATAAGAGGCAATCTACTCGTCCATTCTCATGATGCAGCGCAGGCCCTCCCCCTTGA
GCATGAGGTCGAACGCCGTGTTGATCTGCGAGAAAGGCACGCTGTGGGTGATGAACTTCTCCAGGTCCAGCTCCTTCCTCATGTACATCTCCACGACTTC
CGGGAGGTCGGTCCGCGGCTTGTAGTTGCCGAAGAAGGTGCCCTTCAGGGTCCTCTCATTGAGCAAGTTCATCGGGCTTGTCTTGAACACCGCCTCCTTG
TGCGGGACGCCCACCAGCACCGCCACGCCCCAACCATCATGGACACATTCGAAGGCGGCGATCATGGCGTCGATGTGGCCAGTACACTCAACCGCACGGT
CGACGCCGCCATTGGTCATCTCGACAAGCACCTGGAGAGCAACATTGCACATTGAGTTTTTGGCACAGGATTGTGCATGTCATGAAGAACGAACAAAGGT
GAAAATATGTGTTGAGGGAGATGGAAAGAACTCTTGCACTGGCTTGGTGTGGTCCTTTGGGTTCACAAAGTCGGTGCATCCAAATTTCTTAGCTTGTTCG
TATTTTGCAGGGTTCAAATCCACACCAATGATCCTTGATGCCCCAGACATCTTGGCCCCTTCCATGGCAGCAAGGCCTACAGCTCCNAGACCGAATATGG
CCACCGTCNAACCCTTTTTTCGGTTTC
page-top