Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21875  (registered. 2003)
Contig Information
Length 1380 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Homology (BLAST) Top Hit hypothetical protein OsI_27579 [Oryza sativa Indica Group]
Score 1474
Evalue 2.77755e-161
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21875
TCACTGATGGTGCAAAAATTATGACCGCGTCAGAAAGAAACTGAAGCTAGCAGAACAAGATTTTGATGAACTTGTCCATTCATTAAAGACTCTGATAAAG
TTTGGGTGAAGGCTACAACAATCAGTAGCCTCCTTACACAAAGACCGCGACCAAAAATCACCACACATGCTTGCTTTTTATTAAGCGCCCACGAGGTCAC
ACACTTGACTCACGAACTAAACTCAATTCATCCCTAATAATAATAATAAAAGTGCAGCTAAAACTCCTAAGATTCAACCCCGATGGCGCGACACAATGAG
TCTCTAGTTGCTGCCCTTGCTGATGAGCTCCAGGGCGGTGGCGGTGGTGGGCAGCGCCGGGATGGCTCCCTTCTTGGTGGTGCAGATGGCGCCGCAAGCG
TTCGAGAACTGCAGCACCTCCCTCAGCTTGGCCTCATTGCAGAAGATGGAGTCGTCCTTGGAGACGCTGACGAGGAGGGAGCCGACGAAGGCGTCGCCGG
CGCCGGTGGTGTCCACGGTGTTGACAGAGTAGCCGGGCACCGAGCCCTTGAAGTCCTTGGTGAAGTACCTGCACCCCTTCTCACCATCGGTGACGATGAG
CAGCTTGAGGCCCTCGAACCAGAGGGAGAGCACGTTCTTCTCGTCAGTGGCGTCGCCCTGGGTGAGGAAGGCCACCTCCTCGTCGCTCACCTTGATGAAG
TCAGCCTCTTTCCAGATGCTCATGATGCCGTCACGGGCGGCCTGCGCAGAGGGCCAGAGCGGCAGGCGCACGTTGGGGTCGTACGAGCAAAGGATGCCGG
CCGACTTGGCGGCACGCATGGCGGCGACGTGGGCCGAGCGGCAGGGCTCGGTGATGAGCGAGATGGAGCCGTAGTGAAAGATGCGGGCGCGGCGGATCAG
GTCCAAGTTGAGCTCAGCCTCGGTGAGCAGCATGTCGGCCGACGGGTTGCGGTAGAACATGAACTCGCGCTCGCCGTTAGACTTGAGCGTGACGAAGGCC
AGCGCGGTGCGCGCGTGCTGGTCGAACAGGCAGCCCTCGGCGTTCACGCCGTTCTGCTTCAGGATCTCCACCAGCATGTGGCCGAACTCGTCGTCGCCAA
ACTTTCCGATGAAGGCGGAGGAGCCGCCGAGCTTGGAGATGGCGCAGGCGACGTTGGCGGGGGCGCCGCCGGGGGCCTTGACGAAACCGCCGGACTCGGC
GAGGGAAACGCCGGCAACGTCAGGCACGAAGTCGATCAGCATCTCGCCGAAAGAGACGACGAGGCCAGGGGCGGCGGCGGCCGCCGCGGGGGTAACAGCG
TCACCGAGAGGAGCCATTGGAAGCTTGGTCTAAACGCACGAAACGGAAACGCGAACGCGACGGAAGGATTCGATCGATCG
page-top