Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig753  (registered. 2012)
Contig Information
Length 1177 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|257480752|gb|ACV60508.1|| aquaporin [Triticum aestivum]
Score 589
Evalue 2.00E-166
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig753
TTTTTTTTTTGTTTTTTTTTTAGGGAAGCCACATCAACAAATTATAACTTAAATCTTCCACAATGAGAGCACACACAACTGTCACACACTCACACTGGAG
TCTTAACACACGTAAGTCTGGATTCAGTCAGGAGAGAACATCTTCAGGAGAATCGACGGCGGATGCGGTACTAGGCGCTCGAAACAAGACATCACAAAGA
AGCTCGTTATTCCCGATCAGCTTTTGGTAGCGGAGGCGAGGCGGCTTAGGACCTGCTCTTGTTGAAGGGAATCGCTCTGATGATCACCTGGTGGTAGACG
GCCGCCAGGGCAGCGCCGACGAAAGGGCCCACCCAGAAGATCCAATGGTCATTCCAGGCATGGTCCTTGTTGTAGATGATGGCAGCGCCAAGGCTCCTCG
CTGGGTTGATGCCGGTGCCAGTGATGGGGATGGTGGCCAGGTGGACCAGGAACACCGCGAACCCGATCGGCAGAGGGGCCAGGATAGGAACATGGGAGTC
TCTGGCATTCCTCTTGGCATCGGTAGCCGAGAAGACGGTGTAGACCAGGACGAAGGTGCCGATGATCTCAGCACCAAGGCCATCGCCCTTGGTGTAGCCA
CTGGCGACTACATTGGCGCCGCCACCGTTGCCCATGTACAGACCCTGCTGGAAGCCCTTCACCACTCCAGCTCCACAGATGGCCCCCAGGCATTGCATAA
TTATGTAGAAGACGGCCCTGGTCAGGGACAGCTTCCTGGCCAAGAACAGCCCAAAGGTCACCGCTGGGTTGATGTGTCCTCCTGAGATGCCGGCGGTGCA
GTAGACGAGCGCGAAGATCATGCCGCCGAAGGACCATGCGATGCCCTGGATGCCGACGGTGGCGCACTTGGAGGGGGACTTGGAGACGCCCATGACGGTG
AGCACGGTGACGTAGAGGAAGAGGAAGGTGGCGATGAACTCGGCGATGCCGGCGCGGTAGAAGGACCAGGACTTGAGCTCCCCGGGCTCGAACAGCGGCG
CGGGGGGCGGCTCCTTGTAGTCCTTGTCGTCGCCGCCGCCCTGCGCCGCCGTCCCGATGGGCTGCCGCTCCGAGTACCTGTTGGCGCCCAGCCGCACGTC
CTCCTCCTTCCCCTCCATCGCCCTCTCTCTCTCTCTCTCTCGCTTCCTCTCTGGCTGCTGCTCCGGGAAGGGGAAGT
page-top