Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21869  (registered. 2003)
Contig Information
Length 1393 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_OKCS Seed DPA5 1
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 3
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit Os08g0530400 [Oryza sativa (japonica cultivar-group)] >gi|22759584|dbj|BAC10905.1| Moco containing protein [Oryza sativa Japonica Group] >gi|42407882|dbj|BAD09023.1| Moco containing protein(OsMCP) [Oryza sativa Japonica Group] >gi|42407984|dbj|BAD09122.1| Moco containing protein(OsMCP) [Oryza sativa Japonica Group] >gi|113624295|dbj|BAF24240.1| Os08g0530400 [Oryza sativa (japonica cultivar-group)] >gi|125604117|gb|EAZ43442.1| hypothetical protein OsJ_026925 [Oryza sativa (japonica cultivar-group)]
Score 1975
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21869
AGTCATAGTAATTTCCTCGTATCATATCAGCCAACACAAGCAGTTATTTGTAACGCTGGTAACAAACCAACATAGTTCCATGACAAAGTCTATACGAAAA
TCACAGAAATTAAGCCGTGGTGGCTTTATTATTTGGAGATATCATGGACTCAGCTGGACCGGCGTGCTGCTTGTTCTAGGCACATCAACATACTTCCTTC
ACATTTTTGATCTAGATACGCACGAAGTATTCTGTATTTTGATCCGATGCCAAGATGTGTTGAGGATTCCTCTCAGATTCCATATGTCCTCCACTTTTTC
GGGTTGAATGTTTGCGGCCGAATCCACCGCCTTAGCTACTATCTCGGCATTTGGTGGTATGTCCAATGTGGCCTCAAATAGAACCCATGCCCACTTGTCG
CTTTGAGCTCCATCAGAGACATATGGCACATTGCTTTTCTGATATCTATGAGCTTCAACCCATGTTTTACCCCCATCAACAGATATATCTACCCTCTCAA
TGCCGCGGCCGCCACCTGAGACTGCATATCCAGCAATTCTAGCCTTTCCTTCCTTGATAACATCCACATCTTCCAGGGTGCAAATAGCAGACTGCACAGG
AAAATCCATTTGTGGTCTTCTAGTTGACCAATTAATATTGTCCCAATCTACGGTAGGTGGGAACATCTTGTAATCTTTTTGCATAAAAAAACCCTGGCAT
TCTTCCTTGATTATGTTGATGCTGTCAAGCCATTTTACGGAGCGTGCACCTATAACACCAGGTACGACCACACGGAGTGGATATCCATGGTCACGATTGA
TGGTCTCTCCGTTCATTTCATATGCGAGTAACACATCAGCATCAGGATCTGTTGCCTGCTTTAGTGGAATTGATGCCTTATAGGGGCCACCTTTCTCCTC
TTTACACCTGTCAACACTGACAAACTCAACATGTTTGCCTCCTAAAGATGTGACTGAACTGAGTTTATGTATTCCAACTAGTTCAAGGACATCAGATAGT
TTTGCTCCACCCCAAGTTGCATTTCCAAGAGCAGATACGTCCCATCCAACACCTCTCACTTTCCGCACCTTACTCATTGCAGTTCTCTTATTGCCTGCAC
ACTGTAATGTTGCAGTGACATTGTACTTCGGAAGCATCCTAATGTCATCCATGGACAGCTGGATATGCTTATTCATGAGGCCACTGATGGAAACACTGTA
TCTTGAGATATCATCAACTTTGGGAATTGGTCCATGATTCCTCTTGTAGAAGAAATCCACTGGGGTGATATAAGATGAAACTAACGCAGATCGATGAGGC
TCAGCATTAAATGGCTCCTTGGAGTTGATCCTGAGGGCCGGGTGGCGCGGCGGCTCCTCCGCGTAGTCCGACGGCGCCGTGAGCCCCGGCATC
page-top