Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21866  (registered. 2003)
Contig Information
Length 1046 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 5
Homology (BLAST) Top Hit Os08g0557400 [Oryza sativa (japonica cultivar-group)] >gi|42407944|dbj|BAD09083.1| putative low molecular weight phosphotyrosine protein [Oryza sativa Japonica Group] >gi|113624453|dbj|BAF24398.1| Os08g0557400 [Oryza sativa (japonica cultivar-group)] >gi|215765604|dbj|BAG87301.1| unnamed protein product [Oryza sativa Japonica Group]
Score 854
Evalue 1.45513e-89
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21866
CACTCGCTCACTCGCTTCACAAATCCACGAACCTTAGCTCGCCGTCCGGCCATGGTCGCTGCATCCGTCGCGTCGACCTCCACCCCCGCCGCGTACTCGT
CCTTGGCTCCGAACCCGACAGCGCGTGACCCGGTTAGGACTAGGAGGCGCACTACTCATCCACTTGTGGCAGCCACCAATCGCCACGTGCACGGCCGCAC
TGTGACCAGTCTCCGCCAGATTCACCCTCGCGACCACTTTGCGAACCCTCCGCGGCCCGTATTCGTGGCGTCGGCGGCGGAAGCGGAAGAGATGGCCGCG
GAGGCGAGTACTCCGGCGCCGGCCGAGGCCAGCGCGAAGCCCTTCGCCGTCCTCTTCGTCTGCCTCGGGAACATTTGTAGGAGTCCTGCAGCTGAAGCCG
TCTTCCGGAACCTCGTCAGCAAGCGCGGACTTGAGTCCAAGTTTCAGATAGACTCTGCTGGTACCATAGGTTATCATGAGGGAGATAAGGCCGACTCAAG
GATGATATCAACTTCCAAGAAGCGGGGGATTGAGGTGACCTCAATATCCAGGCCTATCAAACCCTCAGATTTCCGAAATTTTGATCTTATCCTTGCAATG
GACAGGCAGAATTATGAAGACATTTTGAGCTCATTTGACAGATGGCAACACAAGGAGACTCTCCCAGATAGTGGACCCAAGAAGGTTAAGCTGATGTGCT
CCTATTGCAAGCGGCATACGGAGTCTGAAGTTCCAGATCCTTACTATGGAGGCGCTAAGGGATTTGAAAAGGTACTGGATCTGCTGGAAGATGCATGCGA
GTCATTACTTGACAGCATCGTGGCGGAGAAAGAAAACGTTTCTGCTTGATCTCAGAATGAATTTCCCTGAGCCAATGTAAGCGTCACATTTTAATTTGAT
TGTACCAGGAATCAGTTGCAAAGATGTGGAATTAGCTTTCTGTGAGCCATCATCTCTTCAGCCCAGATAATTGTAATGATAATTAACTAAAAATACACTC
TCTCATCATCATGCGTATATATGTGTTAGGCTGGATACATTTCATA
page-top