Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7529  (registered. 2012)
Contig Information
Length 655 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_VWD Shoot grown with dessication 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig7529
TTTTTTTTTTGAACGAGTATACAGCCATGGGAATTCGACGAGTAGCATCCACTGTTTAGTGTAAGTAGGTGCATTCAGATTACACGAGTCAAACCAGGAT
AATACATAGCTACGTACTTAATAATGCCTAAAGCCTCGATCACTACAACCAGGATAGCTAAAACTAAGATAGTGTGTTTCTTATAACCCGCTAAAGGTAA
TATGGTATACTCATAAAGAGCACAGCAGTTGTAGGCACGAGTACAAGAAGAGCAATATCACATTTCTTCTCAAATTTGCGAAGCTCCTTGCGGAAATTTT
CTTCAGGATCAGGCCATTCACGACTGTGAAGTTCTTTCAAAAAATCCAAATCTTTCTGTATATCCTTCATGCTCTGCTCAAAACTTGCTTCAGTGCGATT
GAATTCCTCGCGCCGTTTGGCGCGCGCTTCATCAGAATAAAACAGCTCTTCTTCCTGTGGCTGTGGGACATGGGACATCAGGCGAGAACACGCCGGCGGC
GAGAGCGAGAGCGAGAGCGCGTGCACGAGGCCCGTACGGGGGGCCATCCCGAGCGACCTACCGAGGGCAGGCATCTTCCTGAGGGCAGAGCGAAGCGCCA
TCAGGTCTGTCAGAGCAAGGCGTCGTGGATCTAGGGTTTGTTTGGGTGGTCTGAT
page-top