Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21850  (registered. 2003)
Contig Information
Length 1130 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 5
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsI_30272 [Oryza sativa Indica Group]
Score 612
Evalue 1.88095e-61
Total Hit Count 57
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21850
ACAGTTGCTTCATACGAACTGATAGGCTCACTCATTCATTACAAAACAGACATGGGCAAACAGTTAGCAGCAGCTACTCTAGTTTGCCCTTTGCTGCAGT
GCTATCTACCTGGCCATCTCAAATCTTCACCCAGGCTCCTAACCAAAAATATTTCAAGCTGAGCAATTACCAAGGCTAGAATAAACTTACAATCTGCTCA
CCGCAGACCAACATAGAAAAGCTTTCGGTTTCCCTTTCGCCGTCAATTTGGACAAAACAACAACTTGTTACATGAATGCTAATGCACATTTCATTCTACA
ACACATCAACACCACAATTCCCCACCAATTAGCTGGCTACACCGCCCCCTTCAAGCTGCTGCACCTGTCATACCCTCCTGTAATTCGGATTGATTCCGTA
AGGTAACCAGCTATTGTCATCATACAGGACCTCATGTGCCCCGTTGAAACCATGGGGGTGAAACGACCTATTAATCGCTGGCTGGTGGACTGGCAAAGGA
ACAAACATATGCCGGGCTTGCTGCTGCAGTTGAATCCCAGGATCCGTCGAGTAGATGAAACTACCATGAGGTTGTCCTATCATATGAGGACCTGGATGAA
AGTGTGCTTGTGGCAACCCGTAGGAAAGCTGAGGAATCGGAAGCTGAGATGGATGCACAATCTGATTAAATGGTTGGGTAGAACCTACTTGATGCACATG
AGGCATAAATACAGTGGGAGTTGGTAAAATAGAATCAATCCTGTTAGCAGCGCGGCCGCGTTGTGCAGCGTGCTTCACTTTCTTTTGCTGCTTCTCACTG
TTTGCAGGGTCATGTCGCAACTCCCTCTTCCTCTTGCTCTTAACATGTTTTGGACTGGGGTGACTGACTGGCACATCCTGATTTAACGCCCCAAAAATGA
GGATCTTCAGTGTCGGTGCATCAATTTTACCCCTAAAGAAATCAGTCAATTTGGAAACAGTATCCTTTAGGCATTCACAGATGTTCTGCATCTCCACCTT
CCCTACTGATCTGGCAAAATTCTGAGATCGGTCCAAGAAGTCTTCCACACTCAAGTTACCAATTCCTCTGTTCCAGGTCTTTGAGATCCAGAATCCATCA
AAATTGCTGGCACAAAGCCCTTGCTCCCAT
page-top