Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7526  (registered. 2012)
Contig Information
Length 822 bp
Clones alternative view 54 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 7
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_VABA Shoot with ABA treatment 7
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 11
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|66277464|gb|AAY44603.1|| stress responsive protein [Triticum aestivum]
Score 412
Evalue 2.00E-113
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7526
TTTTTTTTTTGCTCACAAAGGTCCTTTATTGTTACGTAACTTGTCATTACACATACAAGCACAACAGCTCCGTTATTCTGCAGCGTAGATAGCGAGAGAC
GCATGCATGTTTTTATCCAGGACAGACCACAACTCCACATCGTTTCTTCAGTAGATACGTACGCACGCATGGGTAGGTATGGGTATGTGTATGTCGATCT
GCACGCGTACGTGCACGAGCCATGCATGATGCATGCACGGCGCGCGCTGGCTGGCTCAGTAGTACGGCTGGAGCTTCCAGCGTTGGTTGTCGCCCTCGCA
CCACTTCCAGAGCACGACCTCGGTGCCGTCGCGCACGCCGCCGTGGTACTTGTCGCCGTTGAGGGCGTCGAAGTTGAGGTAGATGTTGTTCACCATGCGC
ACACACCTGAAGCCGTTGCCCACGTCCCTGCTCTCCGTCCACAGCACCGACTCGTCCAGGTAGTCTGGGTTGTACGGCACCAGACGCACAGGGTGGGACT
GGCCGAGGGAGTGCTTGATGGCCTGCCCGGTGGCCTTGTTCACCATGGCGAAGGCGGGGTACCCCTCCTCGTCCTTGATGCTGGTGCTCCACCTCATGTC
CTTGATCCAGTGCTGGTAGTCGTCCTTGGGGTTGGCCGGCGCCAGCACCACCTTGCCGTTGCGCACGGACATGGCGTAGTTGGGGTTGGCGCGGCAGTAG
ATCTTCACCGTCGGCTGCGGCGGCATGGGGCGCCCGCCGCAGTTGCCGTCGATGTTCACCTGCGACATGCCGTACGGCACCGGCGCCGCGTACCCGGGCG
TCGCCATCCCGTACCCGCCGTA
page-top