Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7520  (registered. 2012)
Contig Information
Length 598 bp
Clones alternative view 69 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_e Seed DPA10 9
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 5
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 3
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 5
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XA Root 3
WH_XB Root 7
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115435908|ref|NP_001042712.1|| Os01g0273000 [Oryza sativa (japonica cultivar-group)]
Score 150
Evalue 8.00E-35
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7520
GCACGAGGGGCTGGCATCTGTCCCGACGAGCAGCCGCCCCCAGGTCTAGGGTTCCCCCTTTCCTCTTCTCCACGCGAATCAGCTAGATACTAGCACCAGC
ATCGATGGCGGCGGCAGCGCCGGCGGACGCGAAGGCGGAGGCCGCCAAGATGGACCTCCTCGAGGACGACGACGAGTTCGAGGAGTTCGAGATCGACCAA
GAATGGGATGACAAGGAAGATGGCAACGAAGCTGTCCAGCAATGGGAGGATGACTGGGATGATGACGACGTGAACGATGATTTCTCACTGCAGCTGAGGA
AAGAGCTGGAGGGAGGCAACACTCAGAAGAGCTGAACTACTTCGATCAGGCACTGTGTGGCCATTGCTCTCTGAACCTGTGATACTTCCCTAGCAATATC
AAGCTCTGATACTTATCTTCGTTTCAGCACTGTGTATCAGACTTTGTACCTTACTGCATGTAGTTATCGGCTGCGAGCAGCATAACTTGCCGAACAATGA
TAGTTCCCAGAGAGTATCGCAATTACCCAAAAGTTTGTGGACAAAAAAAAAAAAAAAAATGGTCTGCTCCCGGCACTGCGGTACGATTAAAAAAAAAA
page-top