Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21709  (registered. 2003)
Contig Information
Length 1034 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Homology (BLAST) Top Hit Os07g0586200 [Oryza sativa (japonica cultivar-group)] >gi|33147016|dbj|BAC80100.1| putative early nodulin 8 precursor [Oryza sativa Japonica Group] >gi|113611665|dbj|BAF22043.1| Os07g0586200 [Oryza sativa (japonica cultivar-group)] >gi|125600891|gb|EAZ40467.1| hypothetical protein OsJ_023950 [Oryza sativa (japonica cultivar-group)] >gi|215707161|dbj|BAG93621.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1046
Evalue 7.77961e-112
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21709
TTTTTTTTTTGAAGTATAGGTTTCAAATGAAAGTAATTGAAGTATAGTTTTACATCTTCATTTGCAACTTCTATTGGAGTTGCTTTTTTACATCTCCAAT
ATACATCTTCTGTTAGAGTTGACACCTTTGGAGATGCAAAAGACACTTTTCGAAGATGTAAATTTTTACATCTCCAAATTTGCATCTTCTGTCGGAGATG
CTCTTACAGAGAAAGTAGCAGCAGCAGCGGCACGGCCCACCTGACCAACGACCCGCCTGCAGTTCACTGCCCTTTGCTCCGGCAAGCCTGCCTCAGGGGC
ATGGGCGGGTCTGAGAGCCCGCCGCCGACGATCTGATCAAAGAAGAACTTGTTCGCCGCCTCGGTGAAGTGGACGCCGTCCCAGCTCACTCTCCTGGCCG
GGTCGTCGCAGGATTTTCCCAGCACCACCCACTTCCCCTTCACCAGCACCTTCCCGCCACAACCAACCTTCGGGTCGAAGTTGTACGGGCCAGCGTCGTG
CCCGCAGCAGGTGAGCAGAGGGTCGTCGAAGCCTAGCTTGCTGGCTTGGCTGATCAGCTTGTACTTCGCGGCGTAGACATCGACGTAGGTGAACGCGGCG
TCAGGGTAGGTTTTCCGAAGATGAGCCACTGTTTCCTTGAGCCTCTGGTTGAAGAGTTGCGCGACCTTGTTGTAGGTGACAGAGCAGCCAACATTGTCCT
TGACCGCGGCGATGTCGGGCCGGCGAATGAGGGCGTAAGGCAGGCAGCCGATAGGCCCCGTGCTGTGGATCCAGAAGTTCCTTCCACCGAGCACATGCAC
GCTCTGGATTATTGAGGTGAGCCTCTCCATGAGCTCAGGAATGAACGCTACGACTTGTTCACTCGTCATGTTCGCGAAGTAGCCCGCGGTGATGTCGTTT
TGGCCGATGTCGAAGGTGTACAGCGCCTGGGAGAAGTACTCGGCCTTTGGCAGGAGCTCCCTGTAGATGCCACCTTTGTTGTTGTAAACGAACTGGCTTC
TGTTGATGAACTGTTCGAATTCCCAGGACTGCAC
page-top