Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21708  (registered. 2003)
Contig Information
Length 897 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit OSIGBa0132D06.3 [Oryza sativa (indica cultivar-group)]
Score 95
Evalue 1.33554e-05
Total Hit Count 84
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21708
ATATATGACCAAATAGAAGTGTACACCACAGTACTATTCTCACCAGCATCGTTCAATTTTAAAAAGTAAAAAAAAACATCAAACATGGGAAGCTTACCGC
CCATCCGAAAAATCATCATACTCATGGCTATCATACATCATATAACTTTTTTTTACTGAGAAGCCACTATTGAGAAGCCATGTGACAATTAACCACTGCA
TTGTATTTCCCATCACACAATGGACATACATAACTATCCCATATAAACCCAATCACTACTTTCTCCAGTGGCTATTGCCGACAAAATTGGAGCTTCTCAT
GTACACCGGACAAGAAGGAACAAGCAGCCGCACAGCCACCGCACGGCAAAGCAGACGAAGAAGCCCCTCCCTAACCAAACGCAACAGCAGCAGCGCGAGT
ATCCTTATCTCCAATAGTATTTTGGCCTGTGTAGGAGACAAGTGTGCGTTTACATCCAGGAATTTAAGCATCTGCCCAGAGCAATCCCGACCCTCTTCTT
AACAACCCCAGGCTGCTGAAAGAAACCTGTTGCAGTCCTTACATCCATCAAAGAGGATCCTACTAATTCCTATGATGGGTTGTGCATGAGCAAAAATCAA
CATTAACCAACTTGGAACTTTCAAAGATCTGCCCCAGAGTAGGCAATGGACATGATTATGCCACATGCTGCAAGGCCGACAATGACGCCACCATCGCTGC
TGCTGATGAGCGAGGGAGAATATAAAGAGGGCAATATTGCCATAGGTGGGCGCAAGGTTAAAGTTCTCCTTATCTGAGAGAGAGAGAGCGCGCACACACG
GAGCAGCCGCAGCTCGGCGTCGAGGAGGCACAGAGACGGCCGGCCCCCCACCTCCCTTCCTCCTCTCCCGATCCAGGAGCGGATCGAGCCGCCAAAC
page-top