Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7513  (registered. 2012)
Contig Information
Length 1835 bp
Clones alternative view 112 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 8
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 3
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 4
Wh_VSCB Liquid cultured tissue 9
Wh_VWD Shoot grown with dessication 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 5
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XT Roots, 18 day old plants were grown hydroponically 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 5
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|73912433|dbj|BAE20413.1|| aspartic proteinase [Triticum aestivum]
Score 986
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7513
TTTTTTTTTTGACAAGCCGCTAAGCTTCTGGCGTGATAAACCACAGGTTACTAGTAGAAGGTAAACGTTGTTTATCACATACTAATTCAACAACATTGTC
GGAACAAACATCCAGAAACAGTCTCAGCCATCTTAGGAACCACCCTTAGTCATGTCAGGGTCTTTTGAAAAGCAGCATGTAGCATATATACACACACATC
ACCGGTCAAATTCAGAGTAAAAAAGCTAAGCTCTTTCCCGGCGCAAGTGTTCGCCTCCACGATGGGGCGCTCGCTCGATCACCCCTTCAGGCCGCCTTGG
CGAAGCCGACCCGCAGCTTGCCGTAGTCGAAGACGGTGTGGTAGGGGCCCATGAAGACGTCTCCCAGGATCCAGAGAGGACCACGGGGAGGGGGGATGTC
CATGGCTGTGAATCCACTGATGCACTGGGCAGCGGCTCCTTCACCGACCTTCAGGATATACTCTTCTGGTTTCAGCGCAAACTTCTTGCCACCAATGGTG
AACTCAATGTCAGGCATGGATCCAAGGCTCGCACAGTCCACGGCTGACTCTCCCATGGGACTTGGGAGACGGTTGCACAGCTGGTTAACGTAATCTAGTA
TGAGATCCTGGGTCTTGTTCTGTGCAAGTTGGTTCTGCATCCACACAACAGCCATCTCACAGGCACTGCACATGGGATCGGTACGGAGGCCATTCGATTT
CACAGGCTCATCATCGACCACGCTCCGAATTCCAGCACTAACACCACGAGTCCCATCAAAGGTGCACAGACCAACCTGGGAGCAGACCTTTTTGGGCTGT
GTCTCTGCTAGCAACAGGTCGAGGATCTGTTGTCCATACTGAGAAACAATTGTTTTGCACTCTTGGCTGACTACCCCAGCAGCACCAATCTTCTCGTTAA
TTTCAGTAATGATGGCCGTGGGGCCAGCAAGCAGTGAAGTTCCAGAATCAGCAATTGCAGCACAACCGCCAGCACAGAATCCTGTGGACTTCCCTCCAAC
CAGGACATCACCCATGTCAAACTGCCAATATCCCTTCTGGGTGACTGGGACATATGTGTGTTCACCCACGTAGTGTTTAGGATCCATTCCTCCAAAAATA
ATTTCACCACCCTCTCCTTCATCATCAGCATGTCGGTTCAACCAGAATGAGAAAACAGGATCACTGATCAGACCTTGCTCTACCATATTATACCACACAG
GTACTGCTTTGCCAACAGATATTTCCTTAAACCCAAGCCCAAGAATACCATCGAACTTTGCAACCAAGAAAGTAACACCTGGCTCCTTTGTAGCTTCAAT
GAACTCCTGATCTTTCACAACTAGATCACCCACTGTAACACTATCCTCACTGAAATATCCAGCAATTGAACCAGTGCCGTACTGAATGGCAGCAGGCTTT
CCATTCTTCTTGTAGGTGCTGGACGCCCCGGCCTTGTAGCGTGCGTGGAGGTAGCACGCAATCGAGAAGTAGCACTTGGCGGAGGGCACCCAGAGGTTGG
AGCTGCCGGTGTCGAAGATGACGGTGAACTTCTGGGGCGGCGTGCCGACGCCGATCTCCCCGAAGTACTGCGCGTTCATGTAGTTCTTGAGGGACACGAT
GTCGCCCTCCTCCTCGGAGCGGAGGGTGTTGGCGCCGCCGCCGCCGAGGAGGTCCTCGCGGTCGGAGAGGCTCGTGGCGACGCGGCTGTTCCGGTCGATG
GGGCGCTTCTTCAGCGCGATCCGCACCAGGCCCTCCGCGTGGGACGCCGGGAGGAGGGTCTGCAGCAGCACCGCCGCGAGGAGCAGCAGGGCGAGCCCGC
GGGTTCCCATGGTCGCGATCAGAAACCGGAGGAGG
page-top