Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7511  (registered. 2012)
Contig Information
Length 1068 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_h Spike at heading date 1
Wh_DPA20 Seed DPA20 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 7
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XV Leaves, plant was grown at constant 23Ž 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115468228|ref|NP_001057713.1|| Os06g0503400 [Oryza sativa (japonica cultivar-group)]
Score 433
Evalue 1.00E-119
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7511
TTTTTTTTTTCTTTCAAGAACATCCATTCAGGTTTTCACTAAGAACATCCACACGAGAACACATCTGCCGCACGTACACACAAGTAACAGGACAGGTATC
TACAAGCGACTGCGATAGTAGAAAGGTAGCAGTTCGAAGTTTTCAGAGTTGCATATACAAATAGCTAATACAATGCTGAGCAGAAGGCAAGACCGTAAGA
CGAGTGACGTCTCGTCGCATTACGCATATGATCACGGAACCACAAGCGACCCAGCATGCACTCACGAGACACCCAGCATTCTAGGTCTTCTTGGTTTTCG
CCGGTCCTCGGGGTATCTTGCTCAGAACCTTCTGGTCCAGCACCTCGTAGTGCTTGCACGCCTCGGTATGGGCCTTTCCGGCGAAGTGATCCACCTTGTC
CTGGTACTTGTCGTACAAGATCGGCACCGTGTGGATCATCAGGACAGCAATATATATCAAGGTGAGGAAATCACAGCAGCTTCCAACTTCTGACAGAACC
CAGAGACCAGCAATCACACCAAGGAATTTCTTCAGATCATGCCCCATTGCAATCTCGCGCAACAAGTGAAGTGATCTGTTGACATCGCTGCGTAGTGCCC
GTGATACATTCACAGCGAGGTCTTCAGGTATCTCGACTACAGGAATATCTGGCGGACTCTTCTTGATGAAGGTCATAGCTTTCGACCACACGAACAAGAT
GGCCAGGACACCAATCATCACATGGGATAGCAGAGTTAAGAGATGGTAATCAAGCACTTCAAATAAAACCCATATGACAGTTGTGCCACCGATCACTACA
GCAGTTGTTTTCTTGTCCTTCCATAACAGTACATCAGCAGTTTTACCGCCACCGAGCACCTTGTGCACGGAGGTGTCCTCGCCGAGCAGCCTGAACCCCC
GGGACCTCACCGTCGTGTCCGGCGCAGGCGCAGGCGGGGCCGCCTTCTCCGGCGAGGCGTCGGTGCTAGCCGGCGGCTCCGCCGACAGCGGCGGGGCGCC
CTCGGCGGGAGCTGCCGGGGTCGGCGGGGGCGCGGCGACGGTCTCCTCGGCTGGATCGGCCATGGATG
page-top