Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig751  (registered. 2012)
Contig Information
Length 813 bp
Clones alternative view 47 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 4
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 9
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 4
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115447831|ref|NP_001047695.1|| Os02g0670400 [Oryza sativa (japonica cultivar-group)]
Score 215
Evalue 5.00E-54
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig751
TTTTTTTTTTAACCAAGAGCCAATGGCTGGGCAGTCATCAGATTAGCGAATGAAAACAAGTTCTTACACAGGTGGTTAGCAAGAGAAAAGCATTGGAACA
GCTGGTAGCATTCTCAGCTTCCTCTCTGCTAATACACTACTAAGCAACTTCTCAAACCATGAGTCCACAAGTCTAAAAGGGCCCCCTTAACACACAAACA
CAACATCTACTTCCAAATCTCATCATCTAACACTGAGGATAGCAGGATAGCAAACTAGTACACTAAGCGGGGACCCAACACCCAATTTGCTACCTCATAC
TCTGATACACTATTTACTCATCATCGTCCTCGTTTTCCTCATCGCTACCCTCATCTTCGACCTCAGATTTGACCTCCTCATCGTTCTGAGTCTTGGCCTT
CTTGGAGCTCGCACTCTCCTTGTTATCAAAGGTGGCTTTGGTCTTCTCATAGTCCTTCTTCTTCTGTTCAGCCTTTTCCACATAAGGTGCTTTGTCCTCA
TCAGACATAGCTCTCCACTTCTCACCCGCCGCCTTGCTCACGTTGGCGACACTCTTGTTGTTGGGGTTCTCCGCGTTGTACTGCTGCCTGAACTCAGACA
TGAAGACGAAGAAGGCGGAGGGTGGGCGCTTGGGCTTGCCAGCGGCAGCGGCGTCCTTCTTCCTCTTGCTGGCGCCGCCGGCGGCCTTGAGCCTGCCCTC
GCCCTTCTTGGAGGTGTCGGCCTTGCCCTTCATGGTGGAGGTCGCCGCGCGTGTACGGAGCTAGGGTTTTGCGGAGGGACAGAACGGGGGCGGGGCTTGG
TTTGGGAGCGGGG
page-top