Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21664  (registered. 2003)
Contig Information
Length 565 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
Homology (BLAST) Top Hit basic protein 1B, WBP1B=lipid transfer protein homolog [Triticum aestivum=wheat, germ, Peptide, 94 aa] >gi|1092919|prf||2102229B lipid transfer protein:ISOTYPE=WBP1B
Score 374
Evalue 1.96008e-34
Total Hit Count 491
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21664
TTTTTTTTTTAATTTAATCGAGAAATCGCCTATTTTCTCAACATTGACATTATTAAAGGACCATGTATTTCGCTTGTTCATCATCTATATATAGATGTAA
GCATGCATTACAATAGTTCCGACAAAGTACACGAGGTCCCCTCAGGAGTACAAGATCACAGCTCTCGTGGCAACAACTGCGCCACAACGTACGATCGAAG
CAGCAGCAGCAGTAAAACTAATTTATTTATTAGGGAAACAGTAGAACTAGTAAAGCAGTAAATTAAACGCGGTGGAGCCATGCAGCAAGGACGGCCGGCT
TCCACGATTTATTTCGCTCTCACCATGCATCTGAAATGGTTCTGATCTCACGCTTAACGCACCTTGGAGCAATCGGTTCCTTGGCTGATGGCGTAGGGGA
TGTTGACGCCGCACTTGCCGGGGATGCCAGCGACGAGGTTGGGCTTGATGCCGCCTATGCCGCTCGCCTGCTGCTTGAGGCAGGTGCAGGTGGTCTTGCG
GTCGGCGGGGGTGGCAGCCGCCGCGTTAAGGCCACGCACGCCGCTGCAGCAGCCACCGCCAGGCG
page-top