Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21663  (registered. 2003)
Contig Information
Length 1105 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Homology (BLAST) Top Hit unknown protein [Oryza sativa (japonica cultivar-group)] >gi|57863844|gb|AAW56885.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|125592485|gb|EAZ32544.1| hypothetical protein OsJ_016027 [Oryza sativa (japonica cultivar-group)] >gi|215768079|dbj|BAH00308.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195909|gb|EEC78336.1| hypothetical protein OsI_18077 [Oryza sativa Indica Group]
Score 451
Evalue 8.562e-43
Total Hit Count 120
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21663
GTGCATGCATGCATAAACGCACACGAACACAAGCATGCACATCCCGTTACACAGAGCATCGTCTCTCCTCTCCTCTGCTACACGCACGTAGTACTGTAGT
AGGCAGTGCCGTACGTGCTAGCTATTTATTCCCGTCACATGTACACTCATGCATGCAGCTCCACGAACTGCACACGGCACGCTCGAGATCGTCGCTCACA
TGTCGGCGACGCGGCGCTGCTGCTGCGGGCCGGCGACGAACACGGACTCCGGCTGCGCGCGGATGACCCTGTCCGCCTCGTGCCGAATTCGGCACGAGGT
TTTTGGATGCAACTCCTCACAAACATATATGGTATTACTAACGACAATTAATCCAAGGTAGCAGGACTAGCAAAACTTTCAGCAAATAAAGAGTAAACAG
AGAGAGGGGGGAGGGGGTGAAGAACATGAGCCATGATTGGCCGACTTATTGCTTTGTGCTCAGCCTAACAGCTGCTGAGCCTCCTCTGCCTCCTCCTCCT
CCTCCTCCTCCTAGGCAAGGGGGAGGAGGAGCCCTCTTCAATCACTGCATCACAGTGATGAGCTCAAACTCGACCAAGGACACATTGTTGTCCTCCTTCA
CCTTGAAGTCCGCAGGGCTCTCGGCGGCCTTGAGCGTCCCCCACTTGTCCACGGCCAGGCGCATCGACCCCTTGTACATGTCCACCCTCGCCTTCCTCGC
CTCCACGACAGCCCCGGGCTTCATGACGTCCACTTGCTCGTTGCGGGCGGTGAATACGACGACGCCGGTGTCGTCGCCGACGATGCACTCGGCGATGCGC
ATGTTGCCGCCGGCCCTGCCGCCCTGCGGCCTGTGGAGGACGACGGGCTTGGAGCTGAGCACCCGGAGCTGGAGGTTGTGGCCGTAGGTGCCCGGCCGCA
GCTCCTCCACCTTGTCGAACGTCATCGCTGCCCTTTGCCTGGTTTGGTTGTGGACGGTGGAGCGAGCGAGGGAGCGCGTCTCGTCTCCTGCTTGCGCTGC
TTGGATGTGATCTGAAGATGAGATCCGCCGGAGGAAGAAGAAGAAGAAGAAGAAGTTTGTCTCTTGGTTCGTTTGGTTTTGTCCGAGAGGAAGGAGAAAC
CGCCG
page-top