Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21642  (registered. 2003)
Contig Information
Length 912 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 4
Homology (BLAST) Top Hit hypothetical protein OsI_03263 [Oryza sativa Indica Group]
Score 612
Evalue 1.35728e-61
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21642
GGAGAGAAAGCATTCATACTGAACATATTATCTCTAGCTGAAGATATCTGCATACACCATACAACAGGTATATTTCAGTTTGAAGTTTTACAACAGAGGG
AATGTAAGACAAGCAATGGCCCAATATTGTTTCAGAGCTTCTACTGCATAGCGAGCACATAAACACAGTAACCAGTACCAGAACACTTGCCATGGGGAAG
ACCTGGCAGTCTATTGAGTTCGTTCAATAACATATGCTGTCCAAAATTGGCAAGATGTGATGAAGGAAAAGCTGCTGCAAATTCACAATGACGACTCCCC
CAGAAACTAGGCAGTTGCAGCAGGTTCGGCATTAGGAACATACCAACCACGGATTATCTCAATGGCCTTCTTCCTCCTTGCAAGCCTGGACTTGCGATGG
TCTCCAGTATTCCTGTGCATGGCACCAACCTTCACTGTCTTGTCGATGGCTTTGTATGCCTCGGAGATCATTTTCTCTATTTCAATGATTTCTTCAGGTT
GGGCATCAGCTTTCTTTCTAAGCTTTTCAAGGGCTCTGAAAACCTTCTTCATCCGGGTGCGCATCTCGGCCTTGCGAGCATGGTTGCGGATGCGGTGTCT
GTCATTCTGACGCTCCCTCTTCTTGACCGAGTCCGGCTGTCTTCCAGTCTTGGGCGGCTCGGCGGCACACACCACCTGCAGCCCCCTCCTCCTCAGCCTC
CCCGTCGACGCCGAGGCTCCGAACCCACCGATGGGGAAGGCGGCGTAGGAGGTCGACAGGCGGGCCTGTGGGGCGATGGCGCGCAGGGAGAGGGAGGCGG
GTGCCCGGGAAGGGGAGGGGAGGGAGGCCGAGAGGGAAGAGAGGGAGAGGAGCGGTGAGGTGGCGGTGGCCATGGCTGGAGACCAGGATGGGAGGAGTTC
GGGTTGCAGACC
page-top