Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21628  (registered. 2003)
Contig Information
Length 924 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit hypothetical protein OsI_16318 [Oryza sativa Indica Group]
Score 185
Evalue 4.53159e-12
Total Hit Count 222
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21628
CTTGATAGGAAATTATGCCTATTGCTATACCACAACTTGACAACATTAATGTAAATATATACAACCAATTCATACGTCCATAATAGAATCAAGTAACATG
GATCCCACAAAGAGTTTCAGCTTTAGAGCAGAATACTGATCTATCTTTGTCCTTGTATCCTTTTTTCTTCTCCAAACTCGAGTGTGATGCATTTCTCCTA
TTCATGTATCGTGTGCTTCTCCAATGATTCATTCCAAGGGGATGATGGAATCTCCAGATTCAGAGAACTTGAAGTACATTTGGGGATATTCTGGCACATC
TTCACCAGTTTCAATGATGAGATCCCCTTCCTTCCGACGATTTGCCAAAGGGCGAGATCCACCACCCTTTGCATGAGTTGCGAAATATTCAGGTTCATCA
AACACTTTTGGACTCATGGACTCTTGTAGCTTCCCATCAGCGAATTCACTTACTTTCAGAGTGTAAGGCAATTTAGCCTTGTTGACACGGTGGACCATCC
GAACAGTGTCCTTGAATACATCAAACCGGCGAACCATCTCATCATGGTCACGCTTCTGGTTCAAAGTGTTGCACCAGCGCAGATACAAGGCCCACAGGGC
TTCCTCTGACTCAACGTCCTCGTCTGAAGGCAGAATTTTCACCTTACCTGGGAGGGGGGTGAAGGAAGCGGGCGACGACATTTCGTCCGGTGGTGCGTCG
GTGGAGATGGGTGTGTTACCACCGGTGCCGCTGTGGAAGGAGAGGCGGCTCCTCAGATCTGAGGGGGCTGATCGAGCCGCTGTCACCGGCGCTGCCCACC
GACCAGCCGACGCGATCTTGCTGGCGGCGCGAGCAAAGTCACGGGAGGCCCTCAAGAGCATGGACTCCATGCCGGGAAACGAGACGATGGCTCTGGCCTC
TGGATGTGGATGGCGGCGTTCGGT
page-top