Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21547  (registered. 2003)
Contig Information
Length 1160 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Homology (BLAST) Top Hit casein kinase II beta [Hordeum vulgare]
Score 1143
Evalue 4.36679e-129
Total Hit Count 414
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21547
TCAACCCTAGTCCAGCCTGCGAGCGCCGACACGCCGCGCCGTGCGGCTTCCCGCAAGCAGGTGCTCCGGCGGACCGCGGGGGATGAGCGGAGCGGCCTAC
AGGGACCGGGGATTCGGCGGCGCCGCGGAGATGGACCGGAAGCGCATCAAGGAGGCGCTCGAGAAGCACACGGAGAGGCCGTCCCCGCTCCACCTCCAGG
GGGGCGTCCAGGGAGAAGGAGCTGCTCGCCGCCGGCAAGATAACCACTCAGATCGGCAAGGTCCCCAAGGTCTCCGACGTCGAGGAATTTGAAACTGATA
GTGAAGATTCTGATGTTAGTGGTTCTGAAGGAGAGGATACATCTTGGATTTCATGGTTCTGTAGCTTGCGAGGCAATGAATTCTTCTGTGAGATTGATGA
TGATTATATACAGGATGATTTCAATCTCTGTGGCCTAAGCAGTCAGGTGCCATATTATGATTATGCACTTGATCTCATCCTAGACATTGAGTCTTCTAAT
GGTGATGTATTCACTGAGGAGCAAAATGAATTAATCGAGTCATCTGCAGAGATGCTGTATGGTTTAATTCATGCACGGTACATCTTAACCAGCAAGGGTC
TAGCTGCAATGTTAGAAAAGTTCAAGAACTATGATTTTGGCAGATGCCCTCGTGTATACTGCTGTGGTCAACCCTGTCTTCCAGCAGGGCAATCAGACAT
TCCTAGGTCAAGCACAGTGAAGGTGTTTTGTCCAAAATGTGAAGATTTACACTATCCAAGGTCCAAGTACCAAGGCAACATTGATGGAGCATACTTTGGT
ACGACATTCCCTCATCTCTTCTTGATGACATACCCACACCTGAAACCACAGAAGCCATCACAGCAATACGTCCCAAGGGTTTTTGGCTTCAAACTTCACA
AGCAGTCATGACGAACTTTTACCAGCGGGCGCTATTTGTTTTTACCTAGTGTTAGAGATGGAACACCTTGGCCTGAAAATGTTGTGGCCTCTTGATTCGA
GTACTCGCGAGCTCGAATCTTGCTGTAAACTGCTGAGCAACTGTATCTGTTTTGTTGTATGACTCTTGTGTAATCTAGGTTTCCTCACTTGATCAATCTA
TGCACATTTGCATGTTAGCAGGGTGTTTTTCTGTGTCCGAATCGGATACATCTAGATCAC
page-top