Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21544  (registered. 2003)
Contig Information
Length 1105 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 4
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194696546|gb|ACF82357.1| unknown [Zea mays] >gi|194703280|gb|ACF85724.1| unknown [Zea mays] >gi|195643356|gb|ACG41146.1| chaperonin [Zea mays]
Score 1003
Evalue 8.40461e-107
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21544
CTCTCCGCTTTCATAGGGTTTATCTCTTTCCTCCTCCCCTCTCGCGCACGGCAGCCGGATTCCCTACCGCAGGCGAGCCACCACGCCGGCCGGAGCTCGG
CGATAAGATAGTTCTTTAGCAAGCAATCGAGAATGTCGTCGGTGCAGCTCTCTGGTGCTGGTGTTGCTGCGGTGGCTTTCAGCAACAACGGCCTGCGCCT
CTCTCAGACGTCCGCACTCAGGGTGTGCTCATCCAGGCGCTCGTCTCGTAGCCTCGTTGTCAAGGCTGCCACTGTCGTCACCCCCAAGTATACATCACTC
AAGCCTCTTGGAGACAGAGTGCTTGTGAAACTTAGCGCAGCTGAGGAGAAGACCATTGGTGGAATTTTGCTTCCATCCTCCGCGCAGTCTAAGCCTCAGG
GAGGTGAGATTGTTGCTGTTGGAGGCGGTAGAACCATTGGGGATAAGAAGGTGGAGGTCAGCATACCGACCGGATCTCAAGTTGTATACTCAAAGTACGC
TGGTACTGAGGTTGAATACAACAACTCCAAGCATCTTATTATGAAAGAGGATGACATCATAGGTATTCTTGAATCTGATGATGTCAAAGACATGAAGCCT
CTCAATGACCGGATTCTCATCAAGGTTGCAGAGGCTTCAGACAAGACTGAAGCTGGTCTTATCCTCACCGAGACAACCAAGGAGAAGCCATCCATTGGAA
CAGTTGTAGCTGTTGGTCCGGGCTCTCTCGACGAGGAAGGCAAGAGGCAGCCATTGTCGGTGTCACCAGGCAGCACCGTCCTGTACTCCAAGTACGCAGG
CGGCGAGTTCAAGGGTGCTGACGGCACAAACTACATTGTGTTGAGAGTGTCAGATGTGATGGCTGAGCTCTCTTAAGTGTGTTGCTTATTACTTTGTTTC
AGTTTTGAGTTCACGATAGAGGCTAGCATGAGTGGTAACATTGCTATGTGATAACCACTTGATGCTATTTCAGATGATTATAGAATTGTATGAGCAAACC
TGCTGTCCGGGTTAAAAACATTTACCGATTTTGTTTACAAAGGGAGCTTGATGCCGGTTTCCCCCTACTTCTGCATTATGTATGTACATTAGTGCTTGGC
TGATG
page-top