Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21535  (registered. 2003)
Contig Information
Length 1627 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_RDr Root of dessiccated seed 6
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit hypothetical protein OsJ_007140 [Oryza sativa (japonica cultivar-group)]
Score 1881
Evalue 0
Total Hit Count 113
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21535
TCATCATGGAAGCAATGAATCAACAAGAGACTCAGGTTGGAAGCACATTGCTAAGCTCCTCTTCCAAAAATAAAACAAGCACGCAGCGGCCGACGGAGCA
TGCGCTATGCTGTCAGGCCCTCCTTCCATTGTTTTGAATTACATGGTACAAAATCATGAACCCAACACAACCGCCATTCCAACTAAGTCAGCCAGCCACT
GGTATCAAATACAACCGCTAAGCCACGCTCTTCCCCAAGGGGGGCATCACATATTGATGCAAACACCAGAGGCTACCCACTTTCTCTCATGCAGTTGCCA
GGAAGAAGATACCTGTACTGATCAACCTTCTCGAGCAGATAGGCGGGAAGATGAACCGCCGAATACGTACTTGGGATCGGCCCAAGCTTGGCGATGATCT
CTTGGAACGTGTACTCCTCCGGAAGCATATCAAAGAGATCAGCCCCTTGGCATATCACATGCTGAATTCTTTTGGGGTTCAAGAAGTAGCTGAATCTGAT
CCGGTCCACATGGCTGTAGGCTTTCATTTTGAAGACAAAATCATTTATGTACCGAAAGCAAAAGCTGCAGTGCCACCCCGAGTCCGCCAGAAGGTCATCA
GTCTGCCGGTAATGGGCATACCTCGTCTTCCCCGCTCGGTATCTGTGTACCGAAGCCCTCCAACTCTTATCATCAAGCATAAATTGAAATGAGTAGAGAT
AGTTCTTCAGCTGAAGGTGAAGTATCTCGGGCGTATCATCGCACCATCTCAACAGGTTGATTGTATGGCCACTTGGGATCTCATCAACATCCGACATAAT
CAACAGGTCATCGTCGGTGATTCCGGCGATCTTTAGAAGCTGGTCAAGCGCGACTCTCTGATAGGATTCCTCCACAAATGGGTTCTCCCCCTTCACAAAC
CTTCCGCCTATCATACCATAGGTCAACCGTGATTCAGCAAACTCAAACTTTTGGCGGTTTTCCTTGAAGTGGAGCTTCTTTTCAAGGCCAGTAAATGTTG
AATTGGACTCGAGCAGCACAAATTCTGACACATACGGGCTAAGCTCGTGCCAACGGATATCAAGAATGTCGAGCTCGTTGCTGAAAAGCACCGCGTCAAA
GACACGCCGTGGAGCCTCCCGGACCTTCCATCCATGCAACTTGCAGAGGTTTGCCATCGAAGCATTTTCATGATAGTAGTGAGGAAGTACTGTGAAAGGC
TTCGGGGGCTTCTCCCAGATTGGTCTGAGGAAATAAGTGACCTTCTGGCCATGAACATATATGACAAAGATTATAATCGGCACACCAATCAGCAGGAACA
GAAGGGCCTTTAAATCAAACCCCCGAAGTGCACACTTCAGCCTTGACATGCTCAGAACAGCCTTTGAACCATGCCAAATTCGGCCAGCTCGCGAGATTCC
ACCAGCACCAGAAGCAGCATCAAAACCTGGGATTACACCTAATCCCCCCATGTGTAGGACCGAAACAGATCAAAGATTCTTCTTCTTGTAAAGCAACTAA
GCAAGCATCTCGGACCCGGACTAGGCAAATCTCATGGACACTTACTCTAAAACAGAAACCTGCCGACGGAATAACAATAGTATATGGAAGCGTGATATTG
GTGGTAGAATCGAAGCGCGAACAAGAG
page-top