Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21429  (registered. 2003)
Contig Information
Length 887 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsI_38995 [Oryza sativa Indica Group]
Score 794
Evalue 1.01144e-82
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21429
GGCGCCACATACCAGTACCATCGCCTGCCCGCTTTCCCCTCCCCTATCAAATCCTCACTCCACTCGCCCCGCCCAGCCAGATCTTTCTAGAACCTTCAGC
AACCCTAGGGCCCCAGCGAGAGGCCTCTGCCGCCGCCATGGCCCCCAACCCCGCCGCAATCGCCCTCCTGGCCGCCCTCGACGGCAACCTCCGTCTCCTC
AAGAAAATGTCCAAAAAGATGGATTTGCGGGTAACAAAGGACCCTAAAGGGCTGAACGCACTCCATTTCGCTGCAAATAAGGGGTCCCTGGAGATTTGCA
AGTTCCTGGTGGAGGACGTGGGGGTCGATGTCAACTCGGTATCAAGCGTAGGTGCGACACCGATGTTTTACGCTGCACTCAAGGGAAATCTTCAGGTTGC
CAGGTATCTTCTCGATCATGGCAGCGATCCGGCGAAACCCAGTGAGAGGGGCTTAACGCCGCTGCACAATGCAGCAGAGCATGGGCATTGTGAGATTGTA
AAGCTGTTGCTGTCCAAAGGAGTTGACGTGGATGTTATCAATTACCGAGGGACACCATTGCACATGACTGCTGCAAAGGGTCAGCATCAGGCCATGAAAA
TTCTGCTGGAGCATGGTGCTGATCCCAACAGAGTAGTCAATCATATCTTCTCACCACTAATGATGGCATGCTGTGGGAACTCCTTGGAATGCATGAAGCT
ACTGATTGAGGCTGGTGCTGATGTGAATGGTAATAGTAGCTCTGGACCAACTCCTTTAACGGGGGCAGTTGATGATGGCTCAACTGAATTCGCCAAGTTC
TTGCTGGAGGCTGGAGCTGACCCTAACATTCCTAACCAGCACGGGGATATTCCAATCAAGAGAGCAGCAGTCCGTGGNTCAACGTGA
page-top