Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21428  (registered. 2003)
Contig Information
Length 910 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit hypothetical protein OsJ_005354 [Oryza sativa (japonica cultivar-group)]
Score 85
Evalue 1.7348
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21428
TTTTTTTCTTTCTTTTTTTCTTTTTTTTCTTCTGTTTTTTAGTTTGGGCAATGCTCTAATAATGATGATCACCCTGACGAAAGAAATTCCCCTTCTCTCG
CTCCCCCCGTCCCGTGATGGCAGCACCGGCGCCCGGCGCCGGCGCCGTCGAGGTTTCCATGGACGACAAGGCCAAGGCGTTGGTGGCCGCGAAGATCAAG
GAAGGGGAGTACAAGGTGCGGATGATAGGAGAGTACGCGGTGCGGACGGACCGCGCGATCGATGCGCTGGAGAAAAAGGTGCAGGACATCGAGGCGGTGA
TGGATCTCGAGCTGATGCTCGGTGAGTACTGCGCCGACCTCTCGGACATGCACAAGGCGCGCCACTACTACCGCGCCACCTCGCTCTCGGAGGAGGAGAA
GCTCTACCTCCACCAAATCGACGACTTCGCCACCGCCACCATCGCCGAGTACGAGGCCAGCGTCGGCCCCGTCCCGGCCTTCGACAACCACCTCAGCCTG
TTCAGCAAAGACATCCCACTGGAGTTCCCCGAACCCTTGGCTCCCCCTCCGGCTTCTTCGGCTTCGGCTTCGTCTTCGGCTTCTCACCACGAGCCTGCTG
TGGACAATGGAGGGGATGTTGCATGCTAAGAGATGATCACCTGGAGCACCCTATCCCTTTCATTTCTTCGGCCCCGTCATCCAAGTCAGCTATCATGGTT
CTAGGGGCTTTGTACCTATTTTAAGCACGTCTGCAGTTTGACTGGCGGTGATTTTAAACTTGGAGCTGTAAGATTGTCAGTACGGGTGTAGCTATGAACA
TATCTGATGTATGCGAACGTGTTGGTTCTAAAGTGTGATTCATGCTTGCATTGCTCTGTCCCTCGGTGAATTACGAATGCTATCATCACATCGTTTCTAT
AAAAAAAAAC
page-top