Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21387  (registered. 2003)
Contig Information
Length 1500 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 4
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit protein kinase 1 [Aegilops tauschii]
Score 1667
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21387
CCCCTCCCCCGCCAGGCCCCTCCCGCTCCCTCTCCTCGCTCGGGTGCTTCCTCCCTCCCTCTGTCCACTCCACTCGCCACTGGCTCCGTTCGGTCCGTGA
ATCTTGACCGACCCGCCTGAGCCGGCAGCCACCGGTGGCCTGCTGCCGCCTCTCGCTCCAGTGGTGGTGTGGCTACGAGCTGCGGACGGAGGGGGTCCGG
GATGGAGCGGTACGAGGTGATCAAGGACATAGGCTCGGGCAACTTCGGGGTGGCCAAGCTGGTCCGGGACGTCAGGACCAAGGAGCTCTTCGCCGTCAAG
TTCATCGAGAGGGGGCACAAGATTGATGAGAATGTTCAAAGGGAGATTATGAACCACAGATCTCTGAGGCATCCGAATATTGTTAGATTCAAAGAGGTTG
TGCTAACTCCCACACATTTGGCCATAGTTATGGAATACGCTGCTGGCGGTGAGCTATTCGAAAGGATCTGCAGTTCTGGAAGATTTAGCGAGAATGAGGC
TAGGTTCTTCTTCCAACAATTGCTTTCAGGAGTTAGCTATTGCCATTCCATGCAAATATGTCATAGAGATCTGAAACTAGAAAACACACTCCTGGATGGA
AGCGAAGCACCCCGGCTCAAGATATGTGATTTCGGTTACTCCAAGTCCTCTGTGTTGCATTCTCAACCAAAATCAACCGTCGGTACTCCTGCCTACATTG
CCCCCGAGGTCCTTTCTAGAAGGGAATATGATGGAAAGGTCGCTGATGTCTGGTCGTGTGGAGTAACCCTATATGTGATGCTTGTCGGCGCTTATCCTTT
TGAGGACCCAGACGAACCAAAGAATTTCCGCAAGACAATTACTCGGATACTCAGCGTACAATATGCAGTACCCGATTACGTCCGGATTTCAATGGAGTGC
AGGCATTTGCTGTCCCGGATTTTCGTGGCAAACCCTGAGCAACGAATAACCATCCAAGAGATCAAGAACCACCCATGGTTCCTCAAGAATCTGCCGATCG
AGATGACCGACGAGTACCAGATGAGCCTGCATATGGTCGGCGTCAACGCTCCCCCGCAGACCCTGGAGGAGGTCATGGCCATCATCCAGGAGGCACGGAT
ACCGGGCGACGGATCCAAGTTTGCCGGGCAGCTGTCGGTTCCCGGGCTAGGGAGCATGGAGCTCGATGACATAGACGACGTCGACGCGGACGTCGAGGAC
AGCGGCGACTTTGTGTGCGCGTTGTGACGGGCAGGTGTGGTTCCCCTTGGTGGTGTGGCTTTGTGTTTGTAATGTGTTCATCCTTCTGGTGTGTCGTCTG
TTGCAGAGGGTTGCGGTGTGCTGTTGTATGATTACATGTGTTTCTGTAACCGTTGTTCGTAGTGATGCTGTGGATAAAGTATAAGTATAACTATATACTT
CCATATGTGTTTGGTGTCATCAGTAGGATTCCTGGTGATCTGATTCTCTTTACGCTTCGGCAGTTTATATATTTGTTACTATTTTTTTGCAAAAAAAAAA
page-top