Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21375  (registered. 2003)
Contig Information
Length 1001 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 1
Homology (BLAST) Top Hit hypothetical protein OsI_01693 [Oryza sativa Indica Group]
Score 798
Evalue 4.25484e-83
Total Hit Count 140
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21375
GCAAATCATGGATAGTACGCATTTCTGACTTAGAAAAGCTACTAGGCTCATAAATGAACAAACAAGATGACAGTACATGACAGTCAGAGTCGAACGGTCA
ATGTTTATTTGCTAGAATAAGTCACTCTTGTATTTCTCTTCGGATACAGTTCTTCCCCTGGCACATCTAGTGGCCTTTATGCAGTTTTTACATCAACTCT
GAATGAAATTGAAACTCTTAGTGTTGAGGACAGTTAATCTTGTCAAGACTGGAGGGACTTACTATAGCGCTCCTTCGCGAACGCCACAAAACGTTCTAGC
CCATTGAAAAGTAAACCTTCCAGAAATGGTTTCAGGGCTGATGCAACCGGGGTCAGAATTTCAGGAACTTCATAGGCCACCGTTAGTTGTACTCTACAAG
AAGATGAACTCTTAGGGAAGAATCGGACAGCACCCCTGTTAGGAAGACCTTCAAGAGATCGCCAATGAATCTTCTGATTTTTAGTTGGCGTCATGTTCCG
GGCAAGCCAAGAAAATTCTACATCCCGACCAAGTATCGCATACTTCAAAGTCCAACGTGAAAGTTCTGGTTTATCTTCAAGGACCTTGACAGTTGATATG
AATGGCATCCATTGAGGAATAGTCTCACGTTCGGAGTAACACTGGTAGGCCACTGAACATGGAACATCAACTTCAATTTCAGTGCTGCACTCCTGCCACT
CCATGGCAGGGGAGAACAAGGCAGGCCTCGCCCTTGCCCTGCTGCTGCTATTGATGCTGCCACAGCTCGCCTTCCCCTCCCCTCTCCTCCTCCTCATCCA
CCACCGGCTGCTGCTGCGGCCGCCGCTGCTGATAAAGAACACCTTGCTCTGCGATGACCCGAGGCCCGGAGATAGCGAGGAGGGGCTCCCCCTTCCTGCG
GCGGGGTGGTAGTAGCAGGCAGCTCCGGTGGCCATGGCCGTTGCCCGCTCCTCCCCTCTCTCTCTCTCGTGGCTCGTGACGGTGCGGTGTATCGGCACGA
G
page-top