Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21367  (registered. 2003)
Contig Information
Length 1867 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 3
Wh_RDr Root of dessiccated seed 4
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsJ_009249 [Oryza sativa (japonica cultivar-group)]
Score 350
Evalue 8.90006e-31
Total Hit Count 126
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21367
TTTTTGTCACATAAACGCCTTAATAGACACCATACAATACAATTAGTACGATACAGTTAAAAACCATAGAATAAGTACCAAGTCATTTTAAACCACAATC
ATGTCCCACACATACGAATCATATCGTCAACACTTCAGACTTCAGATACAGGCATACTGTGCAGAGCTGACTGGTATCATCACTGCAGCTCCACAAGTTA
AAAAGGAAAACTATCAGCCCCAAAATTACATGACAAGATAATATCACAAGCCCGAGTTATACACATGGTAATAGATGCGCCGCCTTATAGAGCAATCATG
CAGGGAGCATTCTAAGTATCATCATGCCTAAGAGAGAACTATTTTTTATGGCAGATGTTTCGAGTACTACATCAAAAACTCGGTGAAGCTACCATCTACC
TGATGGGGGCTGCAGGAGCTGCGGTACAGATGGCTGCCCTTCAAGTCCTGCCTGTAGAAGTTGCTGCCGCTGCTTCTTCGACCTGTTGGTGTTTGGTGCA
GGGGCATGACAAGCATTTCGCTTACCTACCTGAGCTTTATCTGATTTCTCAACCAGATATTCCGTCAGCACATACGGAATGTAGGTCGGATCGTAAAGAT
ACAACCCCTCAGAAGAACATGGGCATAAGCTCTCCCACTAACTTCCTCTTAGTGTCAACAGCGACAATCCATGCAGTTTCACCCTGCTCATGCAGTTCGG
TCGCGAGGTAAACAACATCGCCGTCGCCACGCAGAGTAGGAGCAGCTGTTTTCAGGTCCTTGAGTGGCACTTTTAGAGCACACGCACCACCACCTCCAAT
CTGAGGCAAGGAGACAGTGCCGAGCTCATCGGAATGGACTGTGTTCCCCTTGCGCCAACAGTTCCAAGTCAATGTCCTATACCATGTGATGAGCCTCCAA
CCAACGATAACATCTTCCTCCTCCTCCTGGGGTGGATCGATGGCCGGTTCCGAGTCTTGGAGCTCATCCATGTCCCAGGGATCAGGAACAACCGAACCAG
TTGTGGCTCTGCGTTCTACCAGCTCCTCAAACTCGACGCACCTGATGTAGCCACGGCTGAAGGTGACGTCACGAATCGCCCGTGCGCGAGATTCATTGTC
GTAGAGTTCATTGTTGCTGGGCAGCAGCTTGGGCATCGGGACGAAGCGCAACGCTGTCACCCCGGGATCGAGCACGTCACAAATCAGGATGCCCTCCATG
AGATTGACCCAACCTAGCAGCCCACCTCCAAGTGCAATCACCTTTACGGGATCGTTCATAGCCGATTTCCTGGCTGCTCCACGGGGGAACTCCACCCGCA
GCAGCTTCTTGGACCATCTGGAGTGCGGCTCGGTGCTGCGGGTGTGGAGATAGTACTGCAGGTCCGTCGGTCCGTCGCTCAGGGCCGCTATGACCAAGTG
CTTGCGGTGGGAGACGAAACCGAGGGGCAGCAGCAGATTCTCTGCGTCAGTATAATCATCGAAGTCCGGGAGCAGATCAAGCGACGGCCGTCCATCGGGC
CCCCTGGCCCGGTAGATGAAGTGCTCCGTCGAGTCGCCGGTGGTGAAGCCAACCCGGATGAGGGCGTGGTCCCCCACGGAGCAGACGACATCTGGCGCGT
CCGTGAAGGTGGTCTTGTCGCGGCCGACGCAGCAGACGCAGAAGTAGGAGAGGCGCGGCGGAGCGGCCACCACCAAGGAGACCTGAAGGGTGAGGCCCGC
CGTCGTCAAGGTCCACGCGGCGGTTGCGTCGCGGAGATCGCTGATGTAGGCGATGGCGTCGAGGATGGCGAAGTCGGGGAAGCGGGGGTTGCCGGCGGCC
ATCGTCGCCGTCCGGGATTGTGGATTTGGGGGGTGAGGGTTAGGGTTCGGCCGATGGATCGAGATTG
page-top