Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21355  (registered. 2003)
Contig Information
Length 538 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 4
Homology (BLAST) Top Hit RecName: Full=Cold-regulated protein BLT14 >gi|18938|emb|CAA40779.1| BLT14 protein [Hordeum vulgare subsp. vulgare] >gi|227753|prf||1710255A cold induced gene BLT14
Score 188
Evalue 6.31035e-13
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21355
GCCACACAACACTATCTCCTCTGTAGTAGTACTACTATTACCAGAGCCGCCTCCCAGTTAGCAATGGCAAAGTGTCTCGCCGTCGCGCTCCTGCTGCTGG
TGGTGCTCGCGTCATGCGAAGGGAGGGAGCTGAATGAGAAGGTTGCAGCGACGCGTGGCGCAGGTGCGGGTGGTGGCGTCGGCGAGTCTAAGGCGTTGGA
CTTGCCTTTGCTCGGGGGAACCGGTACGGGAACCAGCACCATTACCGGCCCGCTGGTGGTGCTTCCTGGGATCCCTGCTATTGGCCCATGATCATCTCTG
GCTCATGTGCTGGCTTACAAGGAGCTAAAGCTCGCCTTGTCGCTTTAGATTCTGTAGGTAGCACCGCCGGGAAGGAAAAAGCGGACGTTTTGCTCATTTC
CATGTTCGGTACTGAGCGCCTGTATCAACTGTCATCTGTACTATCTATTTCCAGTTCATGTTCTCGTATTTTTCGTTCCTTGATGTGCTACATGTACCAT
CAATAAATAATAATTACTATGTTAGTGTAAAAAAAAAA
page-top