Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7475  (registered. 2012)
Contig Information
Length 735 bp
Clones alternative view 42 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 5
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VABA Shoot with ABA treatment 3
Wh_VWD Shoot grown with dessication 7
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|84617221|emb|CAH69206.1|| type 1 non specific lipid transfer protein precursor [Triticum
Score 221
Evalue 8.00E-56
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7475
GCACGAGGCCTCGTGCCGAGCAAATCTAGCTATCTCATCATCTCTGCCTGAGCTCACTACCACTACTATTGCTAGCTTGATCGAGATGGCCCGTTCTGCT
GTTGCTCAGGTCGTGCTCGTCGCCGTGGTGGCCGCTATGCTCCTCGCAGTCACGGAGGCGGCTGTATCGTGCGGTCAGGTGAGCTCTGCCTTGAGCCCCT
GCATCTCCTATGCACGCGGCAACGGCGCCAGCCCGTCTGCGGCCTGCTGCAGCGGCGTTAGGAGTCTAGCCAGCTCAGCCCGGAGCACCGCTGACAAGCA
AGCGGCGTGCAAGTGTATCAAGAGCGCTGCTGCTGGGCTCAACGCTGGCAAGGCCGCCGGCATCCCCACAAAGTGCGGCGTTAGCGTCCCCTACGCCATC
AGCTCTTCGGTCGACTGCTCTAAGATTCGCTGATCGAGCACTTGCTGCCATCGTTGTTGCTATCGTACGTCCCCTACGCCATCGTTGCTGGATCTACGCT
TAGTACGTTGAGGTCACACACACGCACACACATATATATATGAATAAATGCTCTCATATTATCTCACTGCGTGAGAGAGAGAGGAGTACGTCCGTCCAAG
CAGCTCTGTATGGCCGGCCACACTGTTGTATCGATGTTTGGTTGTTCCTCCACTCCCCGAGTTTGCTGTACTTTGTACCATGTGTACTTTTGATATATGG
ATTGTATACACAGCTGATCAGCTCTAAAAAAAAAA
page-top