Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21210  (registered. 2003)
Contig Information
Length 941 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
Wh_VHS Shoot with heat shock treatment 1
Homology (BLAST) Top Hit hypothetical protein OsI_36548 [Oryza sativa Indica Group]
Score 592
Evalue 1.30535e-59
Total Hit Count 47
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21210
TTTGTTTCCGAGACATCAATGTCAATGCATCGAACATGCATACAATTTTTAATATAATAGCCGTGCAACAGCATCAAACTCTTAGCTGTACGAGTCGTAT
TTGTCAGGATTAGGCCTGCTATGTAAACTACCACATCCAATATTTATACCAGTAAACAGAAGTCTCGGAAGGATTTTTTTTAATTACAGAGATGAAACAG
GAAATTAAATTGACTTCCTAGGCAATACCTCAGGCCCACTGCCCTTTCATCAAACCAATACATCAAATTCAGATTTTCTGGAGGTGATTTATGCAACAAT
TGAGATGGCATCATCATGTCGTTGGAGTTTCAGCTATGCCACCTGCCCATACCTTTGAAGATGAAGAATGGGCACATGCAGGCCTTCTTCAGAAACAGTA
GCATGCACTAATTTGAACCAGACGTGGTCACACAAGGGGTAGAAGTGTTGCTAGTACTCGTAGTAGTATTAGAGTTACTTTCGTTAACCCTCTCATTGCT
TGGTTCTGTAGTGAGACAAACTTCAGAAGTAGATGTTGTTGGGCTATAGCTTGGTCTACCACTTCCTCTAGTTTCCAAACGCTCCATCATCCTCGATACA
GATGCAATTCCATTATTAACTTCGCGTCTCACTTCAGAACCAAGATCAGACACAGATGAGTTACGTGAAAAAAGCCTCTCCTTCCACCCTCGAGTACTTT
TTGTAATAGATTCTTTGTACTTCGAGGAGACAGCATTTAAGCGCAACTTTAGAGAATCTGAGAAAGACTGAACATCTGATGGCCCAGCCCTGTCATTACC
TACTGGAGTTGATTGTCCAGAGGAATGTCTCCTGTTGAAAAACCTAGGACTGGATACGGGGGTACTATTTCCAGATGAAACAACAGCATCTTGTTCAGCA
TCATAGGTAAGGACCCCCCGGACTTNGGTTGCCTGCTTCTT
page-top