Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21191  (registered. 2003)
Contig Information
Length 728 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Homology (BLAST) Top Hit RecName: Full=Histone H2B.2
Score 528
Evalue 4.94373e-52
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21191
GACCTCCGTAGCCAAACACCTCCTCCCTCACTCCCACCTCCGAAGCTTCAGCGGCAGCCATGGCCCCCAAGGCAGACAAGAAGCCCGCGGCCGAGAACAA
GGTCGAGAAGGCGGCGGAGAAGACCCCCGCGGGCAAGAAGCCCAAGGCCGAGAAGCGGCTGCCGGCGGGCAAGACGGCGTCCAAGGAGGCCGGCGGCGAG
GGGAAGACCCGGGGCCGGAAGAAGGGCAGCAAGGCGAAGAAGGGCGTGGAGACGTACAAGATCTACATCTTCAAGGTGCTGAAGCAGGTGCACCCCGACA
TCGGCATCTCCTCCAAGGCCATGTCCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGCTCGCCGGCGAGTCCGCCAAGCTCGCCCGCTACAACAA
GAAGCCCACCATCACCTCCCGGGAGATCCAGACCTCCGTCCGCCTCGTCCTCCCCGGCGAGCTCGCCAAGCACGCCGTCTCCGAGGGCACCAAGGCTGTC
ACCAAGTTCACCTCCTCCTAGATTGACTATGCGTCGCTTGTTGTGATAGATGTAGTTGGCTGCTGTTAGTCGCTGACTCTGCTTATGTATCTGCAAGTAG
TGGTAGTAGTAGTCGTCTGTGTGCTGGCTGATTGCCAACGTTTCGTTGGCTAGTTGGTTGTTAGAACTGAAGTTGCTGATCCATCTGAATGTTAATGTTG
CCAGTCGTATTATTACTGAAAAAAAAAA
page-top