Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21181  (registered. 2003)
Contig Information
Length 987 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Homology (BLAST) Top Hit hypothetical protein OsI_37850 [Oryza sativa Indica Group]
Score 1257
Evalue 2.47562e-136
Total Hit Count 38
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21181
GTCTCACCTCCCACGTCGCACCAACCCCCACCCCACCCCCGTCGAAGCGCGGTTTCTTGCGTGGGCGGCCGCCCATCAGGGTGACATCGGAGTTCGACAG
CGAGCGCCAGCTCTTTTCCCACCGCATCTCCTGCCGCGTCCTCAACGGCCTTGCCAAGCTCCGTCTCCGAGTTCACCACGGGGCCGCGGGAGGGGCCCCG
ACTCCCGAGGTGGCGCTCATGGGGCGGAACTTCTCCGCCGTCGTCGACACCGCCTCCCGCGGCGCCGTGCTGCGAGGAACGGCCGACCTTGCCGGATCGC
TCCACCTTAGTGCGGCGCACAACACGAAGGAGGGACAAGGAGAAGTGGCAGTAACTACTAATTTGGGAGATTCACCATGCAAAATTGAGTTATCATCGCT
GGTTCCTCCTGATGGATTGCCAAGAGCAACCTTCTTGTTTCCTAACGGGGAAGTTTCAGTTAAGGAGAAGAAGTTGGATGAGGGTGAGAAAATTTTGTCA
GTAAATGGTATAGTGAAGTCTCATATTCTGAATGGAGTTTGCACTGCATTGTACAATGATAATATGATGAATATCAAGTATCGCTATAAGGATGATGAGC
TATCATTTATTCCCAGCCTCACTTTACCATCAAATTCACTATCATTTGCATTTAAACGCCAGTTAACTCCTTCAGACAAGTTCAGTTACCGGTACCATTT
TGACACGAACTACTGGAGTGCTGTCTATAAACAGAAGGCCAGTAAGCATGTCAAATGGAAAGCAGGTTATGGGTCGGACGAAAGGCTTGGCTGGGCATCT
GTTTGGGTTGGCGACGCAGGCGGCAAGACAAAGGAGGCCCCCCTGAAGACAAAAGTCCAACTCATGATAAAAGTCCCTCAGAACAATATACGGAATTCAA
CTGTAGTGTTCCGGGTGAAGAAAAGATGGGATTTTTAGTTGGGTGTGACTATATCTCATCTAGATGTGAGATACTATCTCACATCTA
page-top