Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7461  (registered. 2012)
Contig Information
Length 1909 bp
Clones alternative view 44 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 3
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 4
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68655495|emb|CAJ01713.1|| methionine synthase 1 enzyme [Hordeum vulgare subsp. vulgare]
Score 1115
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7461
GCACAGCAAACCGGCCCAGGGGAGGGTACTGGGCAAAGGTTTCCACCACCATGGGCTTGGTGGGGATCATCTTGACGAACCCGGCATCACCGTTCTTCAG
GAACTTGGGCGCCGCCTCAATCTGCCTCTCCTCCTCCCCGTTGCTCGCCGCCGTCCCCCTCCGCCTCCGCGCACCCAGGAAAGATGGCGTCCCACATTGT
CGGATACCCGCGCATGGGCCCCAAGAGGGAGCTCAAGTTTGCCCTGGAGTCTTTCTGGGATGGCAAGAGCAGCGCCGAGGATTTGGAGAAGGTTGCCACC
GACCTCAGGGCCAGCATCTGGAAGCAGATGGCTGATGCTGGGATCAAGTACATCCCCAGCAACACCTTCTCCTACTATGATCAGGTTCTTGACACCACCG
CCATGCTCGGTGCCGTCCCAGACCGTTACTCATGGACCGGTGGGGAGATCAATTTGAGCACCTACTTCTCGATGGCTAGGGGCAACGCCACCGTCCCTGC
TATGGAGATGACCAAGTGGTTCGACACCAACTACCACTTTATCGTCCCTGAATTGGCTCCTAGCACCAAGTTCTCCTACTCTTCTCACAAGGCTATCAAT
GAGTACAAGGAGGCTAAGGCGCTTGGCGTTGATACCGTCCCAGTACTTGTCGGACCAGTCTCATACTTGTTGCTCTCAAAGGCCGCCAAGGGTGTAGAGA
AATCATTCTCTCCCCTTTCCCTTCTTAGCAGCATCCTTCCCGTCTACAAGGAGGTTATTGCTGAGCTGAAGGCAGCTGGCGCTTCATGGATTCAGTTTGA
TGAGCCCACCCTTGTTAAGGATCTTGAATCCCACCAACTGTCTGCATTCTCTGCAGCTTACTCAGAACTTGAGTCGGCACTTTCTGGATTGAACGTTCTT
GTTGAGACCTACTTCGCTGACGTCCCTGCAGACTCATACAAGACTCTTACATCATTGAGCAGTGTGACTGCTTATGGTTTTGACCTTGAACGTGGAACCA
AGACTCTTGAGCTTGTCAAGAGTGGTTTCCCCGCTGGAAAGTACCTCTTTGCTGGTGTCGTAGATGGACGCAACATTTGGGCTGATGACCTTGCTGCATC
TCTCGCCACTCTTCAGTCTCTTGAGGCTGTTGTTGGGAAGGACAAGCTTGTCATATCGACTTCCTGCTCACTCATGCACACTGCTGTGGACCTTGTAAAT
GAGACCAAGCTTGATGATGAGATTAAGTCATGGCTCGCATTTGCCGCCCAAAAGGTCGTTGAGGTGAACGCCCTTGCCAAGGCATTGGCTGGTCAAAAGG
ATGAGGCTTACTTCTCTGCAAATGCTGCTGCTCTGGCCTCAAGAAGGTCGTCACCACGTGTCACAAATGAGGAGGTCCAGAAGGCTGCCACCGCCCTCAA
GGGCTCTGATCACCGCCGCGCTACCACCGTTAGCGCTAGGTTGGATGCGCAGCAAAAGAAGCTCAACCTTCCGATCCTTCCCACGACCACCATTGGTTCA
TTCCCACAGACAGTGGAGCTCAGGAGAGTCCGCCGTGAGTACAAGGCAAAGAAGATCTCTGAGGAGGAGTACACCAATGCCATCAAGGAGGAGATTAGCA
AGGTTGTTAAGATCCAAGAAGAGCTTGACATTGATGTGCTTGTGCACGGAGAGCCTGAGAGGAACGATATGGTTGAGTACTTCGGTGAGCAGCTCTCTGG
TTTCACGTTCACTGCCAATGGTTGGGTGCAATCTTACGGATCAAGGTGCGTCAAGCCACCGATCATCTATGGTGATGTGAGCCGCCCCAACCCCATGACC
GTCTTCTGGTCCAAGATGGCGCAGAGCATGACTGCTCGCCCAATGAAGGGTATGCTGACAGGCCCTGTCACAATCCTTAACTGGTCTTTTGTCAGAAATG
ACCAACCGA
page-top