Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7460  (registered. 2012)
Contig Information
Length 1424 bp
Clones alternative view 53 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 1
Wh_EM Dormant seed with water absorption 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XA Root 1
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115485405|ref|NP_001067846.1|| Os11g0455800 [Oryza sativa (japonica cultivar-group)]
Score 688
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7460
TTTTTTTTTTTTTTCTCAACAAAGAAAATAACACATATATTTTTCCCATATGCAGAGCATACACAAAAATAATATGGAAGATTATTGGCAAATACTCGAC
ATTCCATGATCCCAGGCGAACAATTCCTAGAAAGAAATATGATGGAATGTGGACGGCAAACAGAGCATAAAGGTGGGACGCGTTTACAGAACTATCCAGG
GCTCCAGGGCGAGCAGACAAATCTCATAGAAGCACAGCACTGTGGCATTGCGCGGCGGCCAAGAAGGCTTAGAAGCGCATGGCGTATGGACGATTAGCGG
AGACAACCACGACATATGTATCATCATCCTACTCCTTGTACTTCATGCTCTCGAGCGAGAACCCAGGCATGTCGAAGGAGAGGGCAAACTTCTCGACCTC
AACCTTGAGGTTCTCGATGTCCTTGTTGTTCACCAGGCCCTTGGAGAAGTCCTTGAGCAGCTTGCCGTGCTCCTTCTGGATGTTCAGGCAGATGGTCACA
GCCTGGTGGAGGAACTCGGCGATCTGCTCGAAGTCCTTCTCGACCAGACCCCTGGAAGTCATCGCGGGAGCACCAATGCGGACACCACCCGGGGACAATG
CACTGCTGTCACCGAAGACAGCATTCTTGTTCAATGTAATGCTGCAAAGGTCACACATCTTTTCGACCTTGTTTCCAGTCAAGCCAAGAGGGCGGAGATC
CCATAGAACAAGATGGTTGTCAGTTCCATCGGTTACCATCTTGTAACCCTTGCTCATGAGATATTTTCCAACGGCAACAGCGTTGGCCTTGACCTGCTTT
GCATAGGCCTTGAATCCAGGAGTCAAAGTTTGCTTCAGGGCAACTGCAAGGGCAGCAATCTGGTGGTTGTGGGGACCACCCTGGAGCGATGGGAACACCG
CAAAGTTGATCTTGTCCTCATAGTCATACACAGCACCCTCAGGCTGGCCCTTCTTCGCAGGCTTAGGGCCTTTCCTGTAGAAGATCATGCCAGCCCTCGG
TCCCCGGAGAGACTTGTGTGTTGTAGTGGTAACCACATCGCAGAACTCAAAAGGATTTGCAGCTTCCTGCGCGGCGACCAGTCCGCTGATGTGCGCCATG
TCGCAGAGGAGCATGGCCCCGACCTTGTCGGCGACGGCCCTGAGCCTGGCGTAGTCCCAGTCCCTGGGGTAGGCGCTGCCTCCGCAGATGATGAGCTTGG
GGCGGAAGTCCATGGCCTTCTCCTCGAGCTTGTCGTAGTCGATGTAGCCGTTGGCGGCGCTGACCTTGTAGGGCAGGCTCTCGAAGTAGATGGAGGTGGC
GGAGATCTTCTTCCCCCCGGCGGTGTAGTAGCCGTGGGTGAGGTGGCCGCCCGAGGGGAGGTCGAGCCCCATGATCCGGTCGTGCGNNNNNNGAGCGCGG
TGTAGGCGGCGAAGTGGCGGGCGA
page-top