Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21143  (registered. 2003)
Contig Information
Length 1716 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Os05g0148700 [Oryza sativa (japonica cultivar-group)] >gi|42795390|gb|AAS46022.1| PSAG protein; PSAG1 [Oryza sativa (japonica cultivar-group)] >gi|42795392|gb|AAS46023.1| PSAG protein; OsPSAG [Oryza sativa (japonica cultivar-group)] >gi|52353457|gb|AAU44024.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113578202|dbj|BAF16565.1| Os05g0148700 [Oryza sativa (japonica cultivar-group)] >gi|215697263|dbj|BAG91257.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218196093|gb|EEC78520.1| hypothetical protein OsI_18460 [Oryza sativa Indica Group]
Score 834
Evalue 1.96734e-163
Total Hit Count 21
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21143
GCTCCCTGGTACTATCGCGCTTGATCTCCCTCCCCCCTTGCTCCTCCCTCTCGTCCTTCCCCAGTCTCCAAACTCCTTCGCATGAAACAGTACTGAAATA
TCCGTTTCAAATTGGCTGAAAATCTGCTAAATGAAGGCATAGAGATTTTGTCAGGCCAAAGGTTCATAATCTGTAGTAGACATACAGATCGACACATATG
GCTAGCCAAATATCTGGTACCATAGCATCTAGTGGGGTGTGCTATAATGATAAACACAGAATGCCGTGTAAGCTGAAAGCACTACGCTGCGTAGCATCGA
ATTGTTTACCACTAGAGGTAGAGGTAAGGAAGTGGATGAACGGATGTCATATCATCAGGTCCTTTCCAAACGATAGGCATTGGAAAACGAATGCGAAGTC
CAATGGTTACCTACTCCAACAAGGTCCGAATGTTTGGTGCCATTCTTATGGTTCTCGTAGTGCCAGTGAAACTAAAGAGTGCAATATTCCTGAAGATGGC
AACAATCCTTACAGGGATTTTGATGAGCATCCAAGAGGAATGTCACATTTTTCAGATAGTCAAGTTGCAGCTCAGGAAAAAACACTATATTCTACTCAAG
GGCTGTCTAAAGCGTGCCAATTTGTCTATAATGATGCAAAGTTTGTGAATGAAAGAGCTCAGAGTGATATTCTTTTGCTTTCACGTGGCATCACAAGGTT
GAACAAACGTGCATCTAAGGATGTTGCTGTATTAGGATTGGGGTTTCTCAAGCTTGATGATTGCCTGAAAGCTCGTGCAAGGAAGGACACCCGAAAGATT
GATAACAGTGTGAAGGAACGGGCAGCCCACCTAACCAATTTTGCTAGAATATTGAAGGAGCGAGCTCATTCAGACTTGAAGAAAGCAGCAGATCAACATT
GGAGTGATGGTGCTTTGGAGGGCAGATCTGCGACGAGCTGACATGGTTGTTCGACGACGTGCCATGGAGGATGCTTTCATGGCTTTAAAGTTTGTTCGGG
ATATTCATGACATGATGGCAACCAAACTACAATATCAGTTCATCACACTGGAGAAAAATGGGAAGATTCTTAAGTTGTTCCCTCGTGAAGTTTCTACTGA
TCAAATCGCTGCCATAGAGGATGCATATCTTAATATGGCATCTGCCTTATCTGAGGCTGATGGTATCGACTACACCAATCCTGAGGAGCTTGAATTATTA
GTAGCGGCTCTTATTGACCTGGATGCTATGGATGGGAAAAAGAGTGTTTCCTTGATAGTTGAATGTTCAAGTTCTCCAGATGTTAATACCAGGAAAGCTT
TGGCTAATGCATTGGCTGCAGCTCCATCCATGTGGACCCTAGGGAATGCTGGGATGGGCGCATTACAGAGATTGGCTCAAGATTCCAATCCCGCTGTAGC
TAGCTCTGCAGCAAGAGCCATTGGCGAACTCAGAAAGCAGTGGGAGCTTGAAGAGGGTGACAGTCTGAGGTTTGTCATGAACCAAAACTTGATTTCCGAA
GAGACTGACAGCGAGAGTTGAGTAGCAGATGATATCACCACGTGAGGTGTAAATCAGATGAATGACTCAACACGTACAGACTGTAATAGGAACCGAAAAA
CGTGTAACTGAGTCGACTGCATTTCTCTGTGTTACGTCGCAGCATAAAATGTGCTGCTTGTTAACTACCTCACGAGAAGGCATGTCAAGGTACCTGGTAA
GTGCTAAACAAATGTG
page-top