Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig21110  (registered. 2003)
Contig Information
Length 1311 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 4
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsI_31808 [Oryza sativa Indica Group]
Score 1207
Evalue 2.36539e-130
Total Hit Count 406
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig21110
TTTTTTTTTTGCAAAACGTATTTTAATTATTTATTTCTTCACTTGTTTACAAGCGAGCAACTTCAGACCAGAACATGAAATGACCCAAAAAATACAAAGG
AACAAATACAAATTGCCTTGAGACGTATCAACCTGTCTATCCTGGAAAATCACCACTCGGGATGCAGGTTATTCTTCTATATTTTCTACCAAACAAATCA
AGCAAGAACGCAATGTACATCGCAAGCAGCACGGGAAGGCGTCCATCACAGTGCGAGGCCTTCCTTGCGAATTAAGAACCTGTTTGACCTGTGCACCGCA
GCGCTCTTCACAGGCACGTCGAACGCCTTCATCGGTTTCTTGGCATCAATCTGCACGATGGTCTTAGGCTTGGAGTCGAGTGCCTTGACTTCCTTGGTGC
TCTCCAGAAATAACTCCAGACCCTTCACCGGCTTCTTTTCAGTATGAGCCAGGTCCAAGAGCTTGAGTTTTTCATCCGCTTCTTGGAAAAACTTGGCATT
TATTCCCTCTTTTATACCTCCTGCCATTCGGCAGAGATACCATATACCAGCATTAGCCGCATCCTGTTTATTGTCAAGCAACTCAATCTTCTCTTCCAGT
CCAGCTACCATCTGTTGAATTGCTTCAACGTCAAAGCCAATTTGGGACAGATCAGTTTTAACATCAGTGACCTCATTCCGTATTTGTTTGGAGACCTCCA
CTTGTTCGTCCATTTTGCCATCCAAATTCTCAAGGCGTTTTGTTAGATGTCTTTTGGTTGCTGCTAGTGCTGATGAAACTTGCTCCAATTGCTTCGACAT
GCTATCGACAGCACTGGCCATATTGCGTTTTGTGACAAACATGACATCTGACAAGGACCATCCCTTACACCACATATAGCAATAACCTAATGCTCCAACT
GCAGCTGCTGGCAGTATGTAGGACGATAAACTGCCTCCCGAGTCCGATTTGCCGCTCAATATGGTAATGGGCTTTGACAAAGTTAAATCTCTGACTTCTT
GGGCTAAATGCCGAATCTGAGCTTGGATAAGAGCCATGTCATATGCGCTCGAGCCTTCTCCTTGATTTACGCCCTTCATGAGCTCCTGGAGCTCCGCCAA
TACATCCGACAAGCGGCCATTCCGAAGCACGATCGATCCCGTCAGGCCTGCGCCGACGAGGATGAGGACCTTGGAGGCGGCGACCCCCGTGTGCGTCGCC
ATCGCCATGCCCGTGCGCCGCCCCTGCGGGCTCTCTCGTTCGGCTTCTGGGAGGTTCTAGAAGGGGGATCAGTGACGAATGGGGCGGGGAAGGAGACGGG
GGAGGCAGGTG
page-top