Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7453  (registered. 2012)
Contig Information
Length 1465 bp
Clones alternative view 299 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_e Seed DPA10 10
Wh_f Spike at flowering date 7
Wh_h Spike at heading date 4
Wh_r Root 1
Wh_SH - 2
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 18
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 12
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_MS Seed DPA5 of DT3DL CS wheat 13
Wh_OKCS Seed DPA5 9
Wh_SHDr Shoot grown with dessication 11
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 15
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 19
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 7
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 9
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 14
WH_XN Leaves, plant was grown at constant 23Ž 14
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 7
WH_XR Roots, 18 day old plants were grown hydroponically 15
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 20
WH_XT Roots, 18 day old plants were grown hydroponically 11
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_SP 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 14
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 11
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|8918504|dbj|BAA97663.1|| glucose-6-phosphate dehydrogenase [Triticum aestivum]
Score 368
Evalue 9.00E-100
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7453
TTTTTTTTTTGGATCTAATTAAAGACACATTTTGCCATCATGTCTATAGTAGCAAACAATTGATAAGATTGTTATCATGTCCATTAGTATGGGGATAACT
AGAGCAGATTGTTTCTTGAGATGCTAATTAGATAACGCATAAGCATCAGGACATACTATTTTTTTTTTAGGCAGAAACTCCAAATTATTATTGTCTACAC
ATCAGGACGGAACTAGAACAGGTAGGAAAAGGCGCATCACAGCACAAGACGCCTTACACAGCACACGGTACAAGCCACAAGGGGCACGGATAATCCATTA
ACTAGCTCGATACGATACGATAGATCTCGTCTTATTCTGGGTGGCAATTTAAAACGAAACACACGCTTGCGATTCATGCATAACTACTACTCGCTCCTTC
ATCAGGTCCATCCATGCCATCTCCTTGATCTGATTTGATTGAGGCCTCATGGATCACTTGCAGGTGCACGGGTTGCAGGTGCAGTTGGGGCCGCACTTGC
ACCCTCCGTTCTCGGCGGCGGCCTCGAACGACGGGGTGCCCTTGGAGGGGGCAACGCCCATGATGAGGGTCTGGGAGGCGGTGTTCACTCCCTCGTCCAT
CTCAGGGTACATCTTGCACCCTCCGCAGCCGTTGCCGCACTTGCAGCCGGATCCGCACCCGCAGTTGCCTCCGCAGCACGACATGGTTGGTGATGATCGA
ACTCGAGTTTATCCGCTCCGCTCTGTTCTCTGATCTGATCCTCCCCATTCCTACCCACCCAGCATCTCGGCAGTAACTCTCCTCCCTCCCACGCGGCGCG
CCCGCTCGCCGCGCGCGCGAATCTCGGTCGCAACTGGTGTACTGTTGAAGGAAGGAAAAATCATCCTATTTGTCATGGCGGGAACTGACTCCTCGGCGTC
ATCAGACAAAGCAGTTTCAACTCATTAGCAAAGGACCTAGAACTTCCTTTGGAGCAAGGGTGCCTCACCATCGTTGTACTTGGGGCTTCTGGAGATCTTG
CCAAGAAGAAAACGTTCCCGGCACTCTACCACCTTTTTGAGCAGGGGTTCTTACAATCTGGTGAAGTGCATATAGTGGGGTATGCGAGAACAAATCTTTC
TGATGATGGGTTGAGAGGGCGCATCCGTGCATACCTTAAAAGAGCCTCAGAGGAACATGTTTCAGAATTCTTGCAATTGATAAAATATGTCAGTGGTTCC
TATGACAGTGGAGAAGGTTTTGAAAAACTGAACAAGGAAATATCAGATTATGAGATGTCAAACAACTCAGGAAGCTCCCGTAGGCTCTTTTATTTGGCAT
TGCCTCCATCTGTCTACCCTTCAGTGTGCAAAATGATCCGAACATATTGCATGAGTCCAACTTCTCGCGCTGGATGGACTAGAGTAATTGTTGAGAAGCC
CTTTGGAAGGGACCTGGACTCTGCAGAAGNNTTGAGTTCCCAACTTGGGGAGCTATTCGAGGAAG
page-top