Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7451  (registered. 2012)
Contig Information
Length 1307 bp
Clones alternative view 94 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 3
Wh_VWD Shoot grown with dessication 2
WH_XN Leaves, plant was grown at constant 23℃ 7
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 10
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 1
WH_XB Root 2
WH_XE Seedling, infected with leaf rust 30
WH_XF Seedling, infected with leaf rust 6
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 13
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226491884|ref|NP_001141330.1|| hypothetical protein LOC100273421 [Zea mays]
Score 582
Evalue 5.00E-164
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7451
CATACCCCATTACCGTCTTCTCAGACCCTGCTTCGCTGCCGCGAGCTCCGATCGGCAATCGTTTCTCCGTTCAAGATGACCATCATCATCGAGCAGCCTC
AGTTTGATGCGGCGGCGGAGAGGAAGGTCGCCGGCGACCCGGCGGAGCTCGTGCTCGACGGCGGCTTCACCGTGCCGGACTCCAACGCCTTCGGCCACAC
CTTCAGGGACTACGACGCGGAGTCGGAGCGGAAGAAGACGGTGGAGGAGTTCTACAGCGTGAACCACATCAACCAGACGTACGAGTTTGTGCAGCGGATG
CGGGACGCATACGGGCGGCTGGACAAGACGGAGATGAGCATCTGGGAGTGCATCGAGCTGCTCAACGAGTTCATCGACGACAGTGACCCCGACCTGGACA
TGCCGCAGATCGAGCACCTCCTCCAAACCGCCGAGGCCATCCGCAAGGACTACCCCGACGAGGACTGGCTCCACCTCACTGGCCTCATCCATGATCTGGG
CAAGGTGCTGCTGCATCCCAGCTTCGGGGAGCTTCCTCAGTGGGCAGTCGTAGGTGACACCTTCCCCGTCGGCTGCGCGTTCGACGAATGCAACGTCCAC
TCCAAGTACTTCAAGGAGAACCCTGACTACCACAACCCAGAGTTCAACACCAAGTTCGGGGCCTACTCCGAGGGGTGCGGGCTGGACAAGGTGCTCATGT
CATGGGGCCATGACGACTACATGTACCTGGTTGCCAAGGAGAACAAGACCACCCTTCCTTCTGCAGGGCTGTTCATCATCAGATACCACTCCTTCTACCC
CCTGCACAAGCATGGAGCCTACACGCACCTGATGAACGAGGAGGACAAGGAGAACCTCAAATGGCTGCACGTCTTCAACAAGTATGACCTATACAGCAAG
AGCAGCATCAGGATCGACGTCGAGGAAGTGAAGCCCTACTACATGTCGCTCATCGACAAGTACTTCCCGGGGAAGCTGAGATGGTGAGGAGGCCACGCCC
AGACAGGGAACGGAACCCAGACAACATATGATAGTTTATTTACCTTCGTCGAAAGCAAAAAGGAAGAAAGATTGTTACGAGCTGTCGTACGTGTATGGTG
CGTGATACTACTATGTACGGATCATGTCACATCCAAGTTGAGTGAGCGTTGCCAGTAGGGCCATCAGCCATGCGTATTTTGGCGTATACCTAATAAAATT
TATTTGCCGGTATTTGTTGCCTTTCGAGTGTGCTCGGTTCTATTTTTTTTATTAGTTTGAATTGTTTACCACATATGTCACGTGGTGGAGTGTGCTCTGT
TCTACAG
page-top